Incidental Mutation 'R8040:Or8d1'
ID 618472
Institutional Source Beutler Lab
Gene Symbol Or8d1
Ensembl Gene ENSMUSG00000047667
Gene Name olfactory receptor family 8 subfamily D member 1
Synonyms GA_x6K02T2PVTD-32550930-32551856, MOR171-9, MTPCR09, Olfr26
MMRRC Submission 067477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8040 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38766356-38767286 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38766460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 34 (I34N)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
AlphaFold Q7TRB7
Predicted Effect probably damaging
Transcript: ENSMUST00000104874
AA Change: I34N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: I34N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Meta Mutation Damage Score 0.2677 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,765,035 (GRCm39) D675V probably benign Het
Adam21 T C 12: 81,607,211 (GRCm39) R184G probably benign Het
Adcy10 A G 1: 165,379,593 (GRCm39) K952E probably damaging Het
Allc A T 12: 28,605,351 (GRCm39) I316N probably damaging Het
Ano8 T C 8: 71,934,812 (GRCm39) T432A probably benign Het
Cadps2 C A 6: 23,412,942 (GRCm39) probably benign Het
Camsap2 T C 1: 136,208,985 (GRCm39) S168G Het
Ccl19 T C 4: 42,756,297 (GRCm39) S12G probably damaging Het
Cfap91 A G 16: 38,140,733 (GRCm39) S407P possibly damaging Het
Cltc A G 11: 86,616,031 (GRCm39) S412P probably damaging Het
Cwc25 A G 11: 97,641,696 (GRCm39) probably null Het
Cxcr4 A G 1: 128,517,535 (GRCm39) F42S probably damaging Het
Cyp4a12a A G 4: 115,183,412 (GRCm39) Q177R probably benign Het
Dnal4 T C 15: 79,646,169 (GRCm39) T112A probably benign Het
Dock9 C A 14: 121,889,206 (GRCm39) G304C probably benign Het
Evpl T C 11: 116,113,758 (GRCm39) T1311A probably damaging Het
Fat4 T C 3: 39,035,815 (GRCm39) Y3156H probably damaging Het
Golgb1 A G 16: 36,733,841 (GRCm39) I1070M possibly damaging Het
Hcls1 A G 16: 36,771,511 (GRCm39) D139G probably damaging Het
Ighv1-7 A G 12: 114,502,390 (GRCm39) S26P probably benign Het
Il1r1 A T 1: 40,352,509 (GRCm39) T563S probably benign Het
Kcna1 C T 6: 126,619,703 (GRCm39) D206N probably benign Het
Kcnk4 A G 19: 6,904,995 (GRCm39) Y219H probably damaging Het
Kcnt2 G A 1: 140,377,955 (GRCm39) A403T probably damaging Het
Mdp1 T A 14: 55,897,523 (GRCm39) N44I probably benign Het
Nceh1 A G 3: 27,295,374 (GRCm39) N212D probably benign Het
Nynrin G A 14: 56,108,982 (GRCm39) G1363D probably benign Het
Or5d20-ps1 T A 2: 87,931,703 (GRCm39) R209S unknown Het
Or6n1 T C 1: 173,916,723 (GRCm39) I39T possibly damaging Het
Or6x1 A G 9: 40,098,717 (GRCm39) H102R probably damaging Het
Parp2 T A 14: 51,047,630 (GRCm39) M47K probably benign Het
Pfdn6 T C 17: 34,158,951 (GRCm39) probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Plb1 T A 5: 32,430,413 (GRCm39) H123Q possibly damaging Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Prodh2 A G 7: 30,205,836 (GRCm39) D238G probably damaging Het
Rad51ap2 T A 12: 11,508,792 (GRCm39) S905T probably benign Het
Sclt1 C T 3: 41,611,811 (GRCm39) R487H probably damaging Het
Serpina3b A G 12: 104,097,335 (GRCm39) I205M probably benign Het
Sowahb A G 5: 93,191,292 (GRCm39) S476P possibly damaging Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tent4a A G 13: 69,648,600 (GRCm39) Y719H probably damaging Het
Tnxb T C 17: 34,935,532 (GRCm39) Y2611H probably damaging Het
Uggt1 T C 1: 36,250,554 (GRCm39) E237G possibly damaging Het
Vmn1r87 T A 7: 12,866,086 (GRCm39) Y67F possibly damaging Het
Vmn2r107 G A 17: 20,595,808 (GRCm39) C787Y probably damaging Het
Zscan4-ps3 T A 7: 11,346,600 (GRCm39) I212N probably damaging Het
Other mutations in Or8d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Or8d1 APN 9 38,767,095 (GRCm39) missense probably benign 0.00
IGL01909:Or8d1 APN 9 38,767,013 (GRCm39) nonsense probably null
IGL02146:Or8d1 APN 9 38,766,654 (GRCm39) missense probably benign 0.01
IGL02229:Or8d1 APN 9 38,766,712 (GRCm39) missense possibly damaging 0.62
IGL02382:Or8d1 APN 9 38,766,364 (GRCm39) missense probably benign
IGL03007:Or8d1 APN 9 38,766,592 (GRCm39) missense probably damaging 1.00
IGL03118:Or8d1 APN 9 38,766,526 (GRCm39) missense probably damaging 1.00
PIT4403001:Or8d1 UTSW 9 38,766,676 (GRCm39) missense probably benign 0.39
R0590:Or8d1 UTSW 9 38,766,766 (GRCm39) missense probably damaging 0.99
R0862:Or8d1 UTSW 9 38,766,478 (GRCm39) missense possibly damaging 0.89
R1779:Or8d1 UTSW 9 38,766,846 (GRCm39) missense possibly damaging 0.55
R1796:Or8d1 UTSW 9 38,766,820 (GRCm39) missense probably benign 0.01
R2083:Or8d1 UTSW 9 38,766,637 (GRCm39) missense probably benign 0.10
R3420:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R3421:Or8d1 UTSW 9 38,766,621 (GRCm39) missense possibly damaging 0.92
R4328:Or8d1 UTSW 9 38,767,132 (GRCm39) missense possibly damaging 0.62
R4470:Or8d1 UTSW 9 38,766,927 (GRCm39) missense probably damaging 1.00
R4471:Or8d1 UTSW 9 38,766,927 (GRCm39) missense probably damaging 1.00
R5047:Or8d1 UTSW 9 38,766,585 (GRCm39) missense probably benign 0.36
R5267:Or8d1 UTSW 9 38,767,101 (GRCm39) missense probably damaging 1.00
R5318:Or8d1 UTSW 9 38,766,744 (GRCm39) missense probably damaging 1.00
R6502:Or8d1 UTSW 9 38,766,933 (GRCm39) missense probably damaging 0.99
R7221:Or8d1 UTSW 9 38,766,538 (GRCm39) missense probably damaging 1.00
R7297:Or8d1 UTSW 9 38,767,245 (GRCm39) missense probably damaging 1.00
R7448:Or8d1 UTSW 9 38,766,412 (GRCm39) missense probably damaging 1.00
R7525:Or8d1 UTSW 9 38,766,534 (GRCm39) missense possibly damaging 0.89
R8303:Or8d1 UTSW 9 38,766,837 (GRCm39) missense probably damaging 1.00
R8972:Or8d1 UTSW 9 38,767,254 (GRCm39) missense probably damaging 1.00
Z1177:Or8d1 UTSW 9 38,766,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTATGCTCATATTGGTGAGAC -3'
(R):5'- TCATACGCCATGGCAGTCAG -3'

Sequencing Primer
(F):5'- CATTCTGCAGCAGTTGTG -3'
(R):5'- GCCATGCACTCTGAGTAGAC -3'
Posted On 2020-01-23