Incidental Mutation 'R8040:Olfr26'
ID618472
Institutional Source Beutler Lab
Gene Symbol Olfr26
Ensembl Gene ENSMUSG00000047667
Gene Nameolfactory receptor 26
SynonymsMTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8040 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38855060-38855990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38855164 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 34 (I34N)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874] [ENSMUST00000217350]
Predicted Effect probably damaging
Transcript: ENSMUST00000104874
AA Change: I34N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: I34N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217350
Meta Mutation Damage Score 0.2677 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,715,035 D675V probably benign Het
Adam21 T C 12: 81,560,437 R184G probably benign Het
Adcy10 A G 1: 165,552,024 K952E probably damaging Het
Allc A T 12: 28,555,352 I316N probably damaging Het
Ano8 T C 8: 71,482,168 T432A probably benign Het
Cadps2 C A 6: 23,412,943 probably benign Het
Camsap2 T C 1: 136,281,247 S168G Het
Ccl19 T C 4: 42,756,297 S12G probably damaging Het
Cltc A G 11: 86,725,205 S412P probably damaging Het
Cwc25 A G 11: 97,750,870 probably null Het
Cxcr4 A G 1: 128,589,798 F42S probably damaging Het
Cyp4a12a A G 4: 115,326,215 Q177R probably benign Het
Dnal4 T C 15: 79,761,968 T112A probably benign Het
Dock9 C A 14: 121,651,794 G304C probably benign Het
Evpl T C 11: 116,222,932 T1311A probably damaging Het
Fat4 T C 3: 38,981,666 Y3156H probably damaging Het
Golgb1 A G 16: 36,913,479 I1070M possibly damaging Het
Hcls1 A G 16: 36,951,149 D139G probably damaging Het
Ighv1-7 A G 12: 114,538,770 S26P probably benign Het
Il1r1 A T 1: 40,313,349 T563S probably benign Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnk4 A G 19: 6,927,627 Y219H probably damaging Het
Kcnt2 G A 1: 140,450,217 A403T probably damaging Het
Maats1 A G 16: 38,320,371 S407P possibly damaging Het
Mdp1 T A 14: 55,660,066 N44I probably benign Het
Nceh1 A G 3: 27,241,225 N212D probably benign Het
Nynrin G A 14: 55,871,525 G1363D probably benign Het
Olfr1165-ps T A 2: 88,101,359 R209S unknown Het
Olfr429 T C 1: 174,089,157 I39T possibly damaging Het
Olfr986 A G 9: 40,187,421 H102R probably damaging Het
Papd7 A G 13: 69,500,481 Y719H probably damaging Het
Parp2 T A 14: 50,810,173 M47K probably benign Het
Pfdn6 T C 17: 33,939,977 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plb1 T A 5: 32,273,069 H123Q possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Prodh2 A G 7: 30,506,411 D238G probably damaging Het
Rad51ap2 T A 12: 11,458,791 S905T probably benign Het
Sclt1 C T 3: 41,657,376 R487H probably damaging Het
Serpina3b A G 12: 104,131,076 I205M probably benign Het
Sowahb A G 5: 93,043,433 S476P possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tnxb T C 17: 34,716,558 Y2611H probably damaging Het
Uggt1 T C 1: 36,211,473 E237G possibly damaging Het
Vmn1r87 T A 7: 13,132,159 Y67F possibly damaging Het
Vmn2r107 G A 17: 20,375,546 C787Y probably damaging Het
Zscan4-ps3 T A 7: 11,612,673 I212N probably damaging Het
Other mutations in Olfr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Olfr26 APN 9 38855799 missense probably benign 0.00
IGL01909:Olfr26 APN 9 38855717 nonsense probably null
IGL02146:Olfr26 APN 9 38855358 missense probably benign 0.01
IGL02229:Olfr26 APN 9 38855416 missense possibly damaging 0.62
IGL02382:Olfr26 APN 9 38855068 missense probably benign
IGL03007:Olfr26 APN 9 38855296 missense probably damaging 1.00
IGL03118:Olfr26 APN 9 38855230 missense probably damaging 1.00
PIT4403001:Olfr26 UTSW 9 38855380 missense probably benign 0.39
R0590:Olfr26 UTSW 9 38855470 missense probably damaging 0.99
R0862:Olfr26 UTSW 9 38855182 missense possibly damaging 0.89
R1779:Olfr26 UTSW 9 38855550 missense possibly damaging 0.55
R1796:Olfr26 UTSW 9 38855524 missense probably benign 0.01
R2083:Olfr26 UTSW 9 38855341 missense probably benign 0.10
R3420:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R3421:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R4328:Olfr26 UTSW 9 38855836 missense possibly damaging 0.62
R4470:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R4471:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R5047:Olfr26 UTSW 9 38855289 missense probably benign 0.36
R5267:Olfr26 UTSW 9 38855805 missense probably damaging 1.00
R5318:Olfr26 UTSW 9 38855448 missense probably damaging 1.00
R6502:Olfr26 UTSW 9 38855637 missense probably damaging 0.99
R7221:Olfr26 UTSW 9 38855242 missense probably damaging 1.00
R7297:Olfr26 UTSW 9 38855949 missense probably damaging 1.00
R7448:Olfr26 UTSW 9 38855116 missense probably damaging 1.00
R7525:Olfr26 UTSW 9 38855238 missense possibly damaging 0.89
R8303:Olfr26 UTSW 9 38855541 missense probably damaging 1.00
Z1177:Olfr26 UTSW 9 38855235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTATGCTCATATTGGTGAGAC -3'
(R):5'- TCATACGCCATGGCAGTCAG -3'

Sequencing Primer
(F):5'- CATTCTGCAGCAGTTGTG -3'
(R):5'- GCCATGCACTCTGAGTAGAC -3'
Posted On2020-01-23