Incidental Mutation 'R8040:Rad51ap2'
ID618478
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene NameRAD51 associated protein 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8040 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location11456079-11462928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11458791 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 905 (S905T)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
Predicted Effect probably benign
Transcript: ENSMUST00000124065
AA Change: S905T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: S905T

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,715,035 D675V probably benign Het
Adam21 T C 12: 81,560,437 R184G probably benign Het
Adcy10 A G 1: 165,552,024 K952E probably damaging Het
Allc A T 12: 28,555,352 I316N probably damaging Het
Ano8 T C 8: 71,482,168 T432A probably benign Het
Camsap2 T C 1: 136,281,247 S168G Het
Ccl19 T C 4: 42,756,297 S12G probably damaging Het
Cltc A G 11: 86,725,205 S412P probably damaging Het
Cwc25 A G 11: 97,750,870 probably null Het
Cxcr4 A G 1: 128,589,798 F42S probably damaging Het
Cyp4a12a A G 4: 115,326,215 Q177R probably benign Het
Dnal4 T C 15: 79,761,968 T112A probably benign Het
Dock9 C A 14: 121,651,794 G304C probably benign Het
Evpl T C 11: 116,222,932 T1311A probably damaging Het
Fat4 T C 3: 38,981,666 Y3156H probably damaging Het
Golgb1 A G 16: 36,913,479 I1070M possibly damaging Het
Hcls1 A G 16: 36,951,149 D139G probably damaging Het
Ighv1-7 A G 12: 114,538,770 S26P probably benign Het
Il1r1 A T 1: 40,313,349 T563S probably benign Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnk4 A G 19: 6,927,627 Y219H probably damaging Het
Kcnt2 G A 1: 140,450,217 A403T probably damaging Het
Maats1 A G 16: 38,320,371 S407P possibly damaging Het
Mdp1 T A 14: 55,660,066 N44I probably benign Het
Nceh1 A G 3: 27,241,225 N212D probably benign Het
Nynrin G A 14: 55,871,525 G1363D probably benign Het
Olfr26 T A 9: 38,855,164 I34N probably damaging Het
Olfr429 T C 1: 174,089,157 I39T possibly damaging Het
Olfr986 A G 9: 40,187,421 H102R probably damaging Het
Papd7 A G 13: 69,500,481 Y719H probably damaging Het
Parp2 T A 14: 50,810,173 M47K probably benign Het
Pfdn6 T C 17: 33,939,977 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plb1 T A 5: 32,273,069 H123Q possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Prodh2 A G 7: 30,506,411 D238G probably damaging Het
Sclt1 C T 3: 41,657,376 R487H probably damaging Het
Serpina3b A G 12: 104,131,076 I205M probably benign Het
Sowahb A G 5: 93,043,433 S476P possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tnxb T C 17: 34,716,558 Y2611H probably damaging Het
Uggt1 T C 1: 36,211,473 E237G possibly damaging Het
Vmn1r87 T A 7: 13,132,159 Y67F possibly damaging Het
Vmn2r107 G A 17: 20,375,546 C787Y probably damaging Het
Zscan4-ps3 T A 7: 11,612,673 I212N probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11458138 missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11458591 missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11456929 missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11456896 missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11457197 missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11458539 missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11457042 missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11457896 missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11458817 critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11457600 missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11456251 missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11458094 missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11457112 missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11457775 missense probably benign
R1882:Rad51ap2 UTSW 12 11456250 missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11457024 missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11457751 missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11457057 missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11457108 missense probably benign
R2393:Rad51ap2 UTSW 12 11457797 missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11458501 missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11457067 missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11457184 missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11456757 missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11457051 missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11458395 missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11456464 missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11457849 missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11457880 missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11457405 missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11457515 missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11459367 nonsense probably null
R5517:Rad51ap2 UTSW 12 11458312 missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11456920 missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11457533 small deletion probably benign
R5932:Rad51ap2 UTSW 12 11458386 missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11458522 missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11457417 missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11457289 missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11457516 missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11457559 missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11458160 missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11457646 missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11457144 missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11457431 missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11456365 missense probably benign
R7105:Rad51ap2 UTSW 12 11458277 missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11456806 missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11457691 missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11457343 missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11457981 missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11457115 missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11456655 missense probably benign
R7839:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R7916:Rad51ap2 UTSW 12 11456655 missense probably benign
R7922:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
RF023:Rad51ap2 UTSW 12 11458075 missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11458096 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAAATTCCAAGTACCAGGATGAC -3'
(R):5'- ATAAATTCTGCCTTCGATTGACTCC -3'

Sequencing Primer
(F):5'- CAAGTACCAGGATGACAAACAATAG -3'
(R):5'- GTTGTGCATGCCTTTAATCACAG -3'
Posted On2020-01-23