Incidental Mutation 'R8040:Rad51ap2'
ID 618478
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 067477-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8040 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11508792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 905 (S905T)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably benign
Transcript: ENSMUST00000124065
AA Change: S905T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: S905T

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,765,035 (GRCm39) D675V probably benign Het
Adam21 T C 12: 81,607,211 (GRCm39) R184G probably benign Het
Adcy10 A G 1: 165,379,593 (GRCm39) K952E probably damaging Het
Allc A T 12: 28,605,351 (GRCm39) I316N probably damaging Het
Ano8 T C 8: 71,934,812 (GRCm39) T432A probably benign Het
Cadps2 C A 6: 23,412,942 (GRCm39) probably benign Het
Camsap2 T C 1: 136,208,985 (GRCm39) S168G Het
Ccl19 T C 4: 42,756,297 (GRCm39) S12G probably damaging Het
Cfap91 A G 16: 38,140,733 (GRCm39) S407P possibly damaging Het
Cltc A G 11: 86,616,031 (GRCm39) S412P probably damaging Het
Cwc25 A G 11: 97,641,696 (GRCm39) probably null Het
Cxcr4 A G 1: 128,517,535 (GRCm39) F42S probably damaging Het
Cyp4a12a A G 4: 115,183,412 (GRCm39) Q177R probably benign Het
Dnal4 T C 15: 79,646,169 (GRCm39) T112A probably benign Het
Dock9 C A 14: 121,889,206 (GRCm39) G304C probably benign Het
Evpl T C 11: 116,113,758 (GRCm39) T1311A probably damaging Het
Fat4 T C 3: 39,035,815 (GRCm39) Y3156H probably damaging Het
Golgb1 A G 16: 36,733,841 (GRCm39) I1070M possibly damaging Het
Hcls1 A G 16: 36,771,511 (GRCm39) D139G probably damaging Het
Ighv1-7 A G 12: 114,502,390 (GRCm39) S26P probably benign Het
Il1r1 A T 1: 40,352,509 (GRCm39) T563S probably benign Het
Kcna1 C T 6: 126,619,703 (GRCm39) D206N probably benign Het
Kcnk4 A G 19: 6,904,995 (GRCm39) Y219H probably damaging Het
Kcnt2 G A 1: 140,377,955 (GRCm39) A403T probably damaging Het
Mdp1 T A 14: 55,897,523 (GRCm39) N44I probably benign Het
Nceh1 A G 3: 27,295,374 (GRCm39) N212D probably benign Het
Nynrin G A 14: 56,108,982 (GRCm39) G1363D probably benign Het
Or5d20-ps1 T A 2: 87,931,703 (GRCm39) R209S unknown Het
Or6n1 T C 1: 173,916,723 (GRCm39) I39T possibly damaging Het
Or6x1 A G 9: 40,098,717 (GRCm39) H102R probably damaging Het
Or8d1 T A 9: 38,766,460 (GRCm39) I34N probably damaging Het
Parp2 T A 14: 51,047,630 (GRCm39) M47K probably benign Het
Pfdn6 T C 17: 34,158,951 (GRCm39) probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Plb1 T A 5: 32,430,413 (GRCm39) H123Q possibly damaging Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Prodh2 A G 7: 30,205,836 (GRCm39) D238G probably damaging Het
Sclt1 C T 3: 41,611,811 (GRCm39) R487H probably damaging Het
Serpina3b A G 12: 104,097,335 (GRCm39) I205M probably benign Het
Sowahb A G 5: 93,191,292 (GRCm39) S476P possibly damaging Het
Srgap3 C T 6: 112,716,325 (GRCm39) R625H probably benign Het
Tent4a A G 13: 69,648,600 (GRCm39) Y719H probably damaging Het
Tnxb T C 17: 34,935,532 (GRCm39) Y2611H probably damaging Het
Uggt1 T C 1: 36,250,554 (GRCm39) E237G possibly damaging Het
Vmn1r87 T A 7: 12,866,086 (GRCm39) Y67F possibly damaging Het
Vmn2r107 G A 17: 20,595,808 (GRCm39) C787Y probably damaging Het
Zscan4-ps3 T A 7: 11,346,600 (GRCm39) I212N probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAAATTCCAAGTACCAGGATGAC -3'
(R):5'- ATAAATTCTGCCTTCGATTGACTCC -3'

Sequencing Primer
(F):5'- CAAGTACCAGGATGACAAACAATAG -3'
(R):5'- GTTGTGCATGCCTTTAATCACAG -3'
Posted On 2020-01-23