Incidental Mutation 'R8040:Serpina3b'
ID618481
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonymsantitrypsin, A030003A19Rik, alpha-1 antiproteinase, 6A1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8040 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104127996-104139545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104131076 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 205 (I205M)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
Predicted Effect probably benign
Transcript: ENSMUST00000085052
AA Change: I205M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: I205M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,715,035 D675V probably benign Het
Adam21 T C 12: 81,560,437 R184G probably benign Het
Adcy10 A G 1: 165,552,024 K952E probably damaging Het
Allc A T 12: 28,555,352 I316N probably damaging Het
Ano8 T C 8: 71,482,168 T432A probably benign Het
Cadps2 C A 6: 23,412,943 probably benign Het
Camsap2 T C 1: 136,281,247 S168G Het
Ccl19 T C 4: 42,756,297 S12G probably damaging Het
Cltc A G 11: 86,725,205 S412P probably damaging Het
Cwc25 A G 11: 97,750,870 probably null Het
Cxcr4 A G 1: 128,589,798 F42S probably damaging Het
Cyp4a12a A G 4: 115,326,215 Q177R probably benign Het
Dnal4 T C 15: 79,761,968 T112A probably benign Het
Dock9 C A 14: 121,651,794 G304C probably benign Het
Evpl T C 11: 116,222,932 T1311A probably damaging Het
Fat4 T C 3: 38,981,666 Y3156H probably damaging Het
Golgb1 A G 16: 36,913,479 I1070M possibly damaging Het
Hcls1 A G 16: 36,951,149 D139G probably damaging Het
Ighv1-7 A G 12: 114,538,770 S26P probably benign Het
Il1r1 A T 1: 40,313,349 T563S probably benign Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnk4 A G 19: 6,927,627 Y219H probably damaging Het
Kcnt2 G A 1: 140,450,217 A403T probably damaging Het
Maats1 A G 16: 38,320,371 S407P possibly damaging Het
Mdp1 T A 14: 55,660,066 N44I probably benign Het
Nceh1 A G 3: 27,241,225 N212D probably benign Het
Nynrin G A 14: 55,871,525 G1363D probably benign Het
Olfr1165-ps T A 2: 88,101,359 R209S unknown Het
Olfr26 T A 9: 38,855,164 I34N probably damaging Het
Olfr429 T C 1: 174,089,157 I39T possibly damaging Het
Olfr986 A G 9: 40,187,421 H102R probably damaging Het
Papd7 A G 13: 69,500,481 Y719H probably damaging Het
Parp2 T A 14: 50,810,173 M47K probably benign Het
Pfdn6 T C 17: 33,939,977 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plb1 T A 5: 32,273,069 H123Q possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Prodh2 A G 7: 30,506,411 D238G probably damaging Het
Rad51ap2 T A 12: 11,458,791 S905T probably benign Het
Sclt1 C T 3: 41,657,376 R487H probably damaging Het
Sowahb A G 5: 93,043,433 S476P possibly damaging Het
Srgap3 C T 6: 112,739,364 R625H probably benign Het
Tnxb T C 17: 34,716,558 Y2611H probably damaging Het
Uggt1 T C 1: 36,211,473 E237G possibly damaging Het
Vmn1r87 T A 7: 13,132,159 Y67F possibly damaging Het
Vmn2r107 G A 17: 20,375,546 C787Y probably damaging Het
Zscan4-ps3 T A 7: 11,612,673 I212N probably damaging Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104138787 missense probably benign 0.03
IGL00427:Serpina3b APN 12 104132941 missense probably benign 0.06
IGL01637:Serpina3b APN 12 104132957 missense probably benign 0.00
IGL01738:Serpina3b APN 12 104130832 missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104130462 start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104131054 missense probably benign 0.22
R0141:Serpina3b UTSW 12 104130771 missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104130727 missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104130670 missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104130879 missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104138710 missense probably benign 0.02
R1802:Serpina3b UTSW 12 104138637 missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104138810 missense probably benign 0.01
R3871:Serpina3b UTSW 12 104138788 missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104130630 missense possibly damaging 0.80
R5827:Serpina3b UTSW 12 104130777 missense probably benign 0.02
R5970:Serpina3b UTSW 12 104134091 missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104131097 missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104134169 missense probably benign 0.00
R6673:Serpina3b UTSW 12 104130669 missense probably damaging 0.96
R6807:Serpina3b UTSW 12 104132992 missense probably benign 0.00
R6836:Serpina3b UTSW 12 104134082 missense probably benign 0.30
R6893:Serpina3b UTSW 12 104133026 missense probably benign 0.04
R7414:Serpina3b UTSW 12 104132886 missense probably benign 0.03
R7539:Serpina3b UTSW 12 104130711 missense possibly damaging 0.75
R7748:Serpina3b UTSW 12 104130463 start codon destroyed probably null 1.00
R7817:Serpina3b UTSW 12 104132964 missense probably benign 0.01
R8143:Serpina3b UTSW 12 104130534 missense probably benign 0.06
R8360:Serpina3b UTSW 12 104138703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCTGTTTGTTGAAAAGCAC -3'
(R):5'- GACATGTCCCAGGAATTACATCAC -3'

Sequencing Primer
(F):5'- CTGTTTGTTGAAAAGCACCTGCAG -3'
(R):5'- TCACTATCTTAAAATTCTCAGAGGGG -3'
Posted On2020-01-23