Incidental Mutation 'R8041:Cntnap5a'
ID618497
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116259479 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 594 (Y594N)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect probably damaging
Transcript: ENSMUST00000043725
AA Change: Y594N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: Y594N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
R7137:Cntnap5a UTSW 1 116089376 missense probably damaging 1.00
R7290:Cntnap5a UTSW 1 116221889 missense probably damaging 1.00
R7342:Cntnap5a UTSW 1 116060122 missense probably benign 0.00
R7367:Cntnap5a UTSW 1 116442295 missense probably benign 0.00
R7373:Cntnap5a UTSW 1 116580637 missense probably benign 0.20
R7426:Cntnap5a UTSW 1 116442380 missense probably benign 0.03
R7444:Cntnap5a UTSW 1 116292349 missense probably benign
R7582:Cntnap5a UTSW 1 116446632 missense probably damaging 1.00
R7745:Cntnap5a UTSW 1 116442283 missense probably benign
R7948:Cntnap5a UTSW 1 116580528 missense probably benign 0.01
R7995:Cntnap5a UTSW 1 116571547 missense probably damaging 0.99
R8262:Cntnap5a UTSW 1 116188410 missense possibly damaging 0.66
R8273:Cntnap5a UTSW 1 116571541 missense probably damaging 1.00
R8320:Cntnap5a UTSW 1 116446736 missense possibly damaging 0.62
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Z1176:Cntnap5a UTSW 1 116428516 missense probably damaging 1.00
Z1177:Cntnap5a UTSW 1 116412168 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGTAAAAGTCTGCCAAGTATCAC -3'
(R):5'- GTCCTGACCACCAAGATCTC -3'

Sequencing Primer
(F):5'- CAACACCGAGCTATAAAGTCTCTTG -3'
(R):5'- CCCCATGAAGTTGTCCTGTG -3'
Posted On2020-01-23