Incidental Mutation 'R8041:Cd48'
ID618500
Institutional Source Beutler Lab
Gene Symbol Cd48
Ensembl Gene ENSMUSG00000015355
Gene NameCD48 antigen
SynonymsBcm-1, BCM1, BLAST-1, Sgp-60
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171682009-171705258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171699390 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000064241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015499] [ENSMUST00000068584]
PDB Structure
Structure of NK cell receptor 2B4 (CD244) bound to its ligand CD48 [X-RAY DIFFRACTION]
Structure of NK cell receptor ligand CD48 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015499
SMART Domains Protein: ENSMUSP00000015499
Gene: ENSMUSG00000015355

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068584
AA Change: V128A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064241
Gene: ENSMUSG00000015355
AA Change: V128A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 28 125 1.96e-6 SMART
IG_like 136 211 1.24e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in a slight increase in CD4+CD8- thymocytes and impaired T cell proliferation in response to mitogens, anti-CD3 antibodies, and alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Cd48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Cd48 APN 1 171695739 missense possibly damaging 0.95
IGL03140:Cd48 APN 1 171695883 missense probably damaging 1.00
R0311:Cd48 UTSW 1 171699580 nonsense probably null
R0490:Cd48 UTSW 1 171704877 makesense probably null
R1365:Cd48 UTSW 1 171699561 missense probably damaging 0.98
R1503:Cd48 UTSW 1 171695847 missense probably damaging 1.00
R1626:Cd48 UTSW 1 171682119 missense probably benign 0.30
R1628:Cd48 UTSW 1 171704852 missense probably damaging 0.99
R4076:Cd48 UTSW 1 171695883 missense probably damaging 1.00
R4753:Cd48 UTSW 1 171699588 missense probably damaging 0.99
R5488:Cd48 UTSW 1 171695705 missense possibly damaging 0.94
R6365:Cd48 UTSW 1 171682164 missense probably null 0.84
R7216:Cd48 UTSW 1 171695822 missense probably damaging 1.00
R7400:Cd48 UTSW 1 171695925 missense probably benign 0.00
R7702:Cd48 UTSW 1 171695780 missense probably damaging 0.99
Z1088:Cd48 UTSW 1 171695727 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAAAATTGCTCGCTGGCTC -3'
(R):5'- TGCTGCTTACAGGATTGCTG -3'

Sequencing Primer
(F):5'- TGGCTCCATCTGTAGGAGACTC -3'
(R):5'- ACAGGATTGCTGACTTGGCAG -3'
Posted On2020-01-23