Incidental Mutation 'R8041:Ifi207'
ID618501
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Nameinterferon activated gene 207
SynonymsPyhin-A, AI607873
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173723427-173741747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173727702 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 805 (R805G)
Ref Sequence ENSEMBL: ENSMUSP00000119350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042610
AA Change: R812G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: R812G

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 162 N/A INTRINSIC
low complexity region 207 215 N/A INTRINSIC
internal_repeat_1 286 472 4.17e-7 PROSPERO
low complexity region 476 496 N/A INTRINSIC
internal_repeat_1 565 782 4.17e-7 PROSPERO
Pfam:HIN 788 954 4.9e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127730
AA Change: R805G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: R805G

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173725044 missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173736441 missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173723748 missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173727593 missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173735104 splice site probably benign
PIT4458001:Ifi207 UTSW 1 173735172 missense unknown
R0043:Ifi207 UTSW 1 173729112 missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173736398 missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173729865 missense possibly damaging 0.85
R0506:Ifi207 UTSW 1 173736312 missense possibly damaging 0.52
R0843:Ifi207 UTSW 1 173727577 missense probably damaging 1.00
R1302:Ifi207 UTSW 1 173735295 missense possibly damaging 0.96
R1373:Ifi207 UTSW 1 173730347 missense unknown
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173730063 missense unknown
R1502:Ifi207 UTSW 1 173729306 missense possibly damaging 0.56
R1533:Ifi207 UTSW 1 173727740 missense probably benign 0.30
R1831:Ifi207 UTSW 1 173732426 missense unknown
R1928:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R1982:Ifi207 UTSW 1 173735239 missense probably benign 0.01
R2132:Ifi207 UTSW 1 173729771 missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173736470 splice site probably benign
R3703:Ifi207 UTSW 1 173727463 nonsense probably null
R3741:Ifi207 UTSW 1 173727562 missense probably damaging 1.00
R3846:Ifi207 UTSW 1 173735303 missense probably benign 0.33
R4747:Ifi207 UTSW 1 173729067 missense probably benign 0.00
R4772:Ifi207 UTSW 1 173727687 missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173730056 missense unknown
R4855:Ifi207 UTSW 1 173729815 missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173730498 missense unknown
R5244:Ifi207 UTSW 1 173729937 missense probably benign 0.04
R5280:Ifi207 UTSW 1 173730304 missense unknown
R5301:Ifi207 UTSW 1 173729411 missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173727531 missense probably benign 0.21
R5445:Ifi207 UTSW 1 173727797 missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173732426 missense unknown
R5838:Ifi207 UTSW 1 173732387 missense unknown
R6060:Ifi207 UTSW 1 173730527 missense unknown
R6220:Ifi207 UTSW 1 173729546 missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173727545 missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173725053 missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173729966 missense probably benign 0.01
R6394:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R6532:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173729406 missense probably benign 0.01
R6893:Ifi207 UTSW 1 173727642 missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173730252 missense unknown
R7192:Ifi207 UTSW 1 173729018 missense not run
R7194:Ifi207 UTSW 1 173729924 missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R7348:Ifi207 UTSW 1 173729196 small deletion probably benign
R7404:Ifi207 UTSW 1 173728928 missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173727431 missense probably benign 0.03
R7784:Ifi207 UTSW 1 173730132 missense unknown
R8116:Ifi207 UTSW 1 173730180 missense unknown
R8383:Ifi207 UTSW 1 173729204 small deletion probably benign
R8388:Ifi207 UTSW 1 173729450 frame shift probably null
R8389:Ifi207 UTSW 1 173729450 frame shift probably null
R8390:Ifi207 UTSW 1 173729450 frame shift probably null
R8399:Ifi207 UTSW 1 173730278 missense unknown
RF009:Ifi207 UTSW 1 173728992 missense probably benign 0.00
RF011:Ifi207 UTSW 1 173729121 missense not run
RF032:Ifi207 UTSW 1 173735157 small deletion probably benign
X0003:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
Z1177:Ifi207 UTSW 1 173729579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACGTTCACATCAGAGACACAGG -3'
(R):5'- GGCAACCATTGTTTATATGTTCTCC -3'

Sequencing Primer
(F):5'- GAGACACAGGAAGCTCTGTATATCTC -3'
(R):5'- ATATGTTCTCCATTCTATTCAGTGGC -3'
Posted On2020-01-23