Incidental Mutation 'R8041:Mamdc4'
ID618503
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25564695 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1035 (F1035S)
Ref Sequence ENSEMBL: ENSMUSP00000092735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095117
AA Change: F1035S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: F1035S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114223
AA Change: F1031S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: F1031S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152237
AA Change: F932S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: F932S

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
IGL03048:Mamdc4 UTSW 2 25569072 missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25566024 missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25569692 critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25566332 missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25565773 missense probably benign
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25568965 missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25565546 missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25564461 missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25565348 missense possibly damaging 0.88
R7627:Mamdc4 UTSW 2 25568213 missense probably damaging 1.00
R7875:Mamdc4 UTSW 2 25568665 nonsense probably null
R7958:Mamdc4 UTSW 2 25568665 nonsense probably null
R8144:Mamdc4 UTSW 2 25567007 missense probably damaging 0.99
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTGTGCCTAACCTGAGCCC -3'
(R):5'- GACTTTGAAACTGGCCTGTG -3'

Sequencing Primer
(F):5'- AACCTGAGCCCCTGTTCC -3'
(R):5'- ACTGGAGTAGTGGAGCCAC -3'
Posted On2020-01-23