Incidental Mutation 'R8041:Slc6a17'
ID618509
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 17
SynonymsNTT4, D130012J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107467543-107518018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107474428 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 446 (T446S)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
Predicted Effect probably damaging
Transcript: ENSMUST00000029499
AA Change: T443S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: T443S

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168211
AA Change: T405S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: T405S

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169449
AA Change: T446S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: T446S

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107493177 missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107495677 missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107477306 missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107495740 missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107495740 missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107476867 missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107493072 missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107472127 missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107474386 missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107473579 missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107491501 nonsense probably null
R3708:Slc6a17 UTSW 3 107493085 missense probably benign
R3814:Slc6a17 UTSW 3 107471317 missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107474281 missense probably benign
R4807:Slc6a17 UTSW 3 107500487 missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107471437 nonsense probably null
R6076:Slc6a17 UTSW 3 107472071 missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107500406 missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107471387 missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107471439 missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107493148 missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107491478 missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107471352 missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107474355 missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107476898 missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107495740 missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107473585 missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107473669 missense probably benign
X0010:Slc6a17 UTSW 3 107493106 missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107500368 missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107476766 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAATTGCCATGCACATGCTGG -3'
(R):5'- GTTCAAGACCCACTCTCTGG -3'

Sequencing Primer
(F):5'- CACATGCTGGGCTGGTGTC -3'
(R):5'- ACTCTCTGGAGCCGAAAGAGTTC -3'
Posted On2020-01-23