Incidental Mutation 'R0661:Drd1'
List |< first << previous [record 13 of 42] next >> last >|
ID61851
Institutional Source Beutler Lab
Gene Symbol Drd1
Ensembl Gene ENSMUSG00000021478
Gene Namedopamine receptor D1
SynonymsDrd1a, D1 receptor, C030036C15Rik, Gpcr15, Drd-1
MMRRC Submission 038846-MU
Accession Numbers

Genbank: NM_010076.3; Ensembl: ENSMUST00000021932

Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R0661 (G1)
Quality Score140
Status Not validated
Chromosome13
Chromosomal Location54051183-54055705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54053038 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 379 (N379Y)
Ref Sequence ENSEMBL: ENSMUSP00000152768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021932] [ENSMUST00000221470]
Predicted Effect probably benign
Transcript: ENSMUST00000021932
AA Change: N386Y

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021932
Gene: ENSMUSG00000021478
AA Change: N386Y

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 244 7.9e-10 PFAM
Pfam:7TM_GPCR_Srsx 33 345 7e-11 PFAM
Pfam:7tm_1 39 331 6.5e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221470
AA Change: N379Y

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222706
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D1 subtype of the dopamine receptor. The D1 subtype is the most abundant dopamine receptor in the central nervous system. This G-protein coupled receptor stimulates adenylyl cyclase and activates cyclic AMP-dependent protein kinases. D1 receptors regulate neuronal growth and development, mediate some behavioral responses, and modulate dopamine receptor D2-mediated events. Alternate transcription initiation sites result in two transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show variably abnormalities that may include growth retardation, death after weaning unless given hydrated food, nonresponsiveness to dopamine D1 receptor agonists and antagonists, and normal to hyperactive locomotor activity. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Drd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Drd1 APN 13 54053878 missense probably damaging 1.00
IGL00231:Drd1 APN 13 54053467 missense probably benign
1mM(1):Drd1 UTSW 13 54053847 missense probably damaging 1.00
H8786:Drd1 UTSW 13 54053103 missense possibly damaging 0.92
R0166:Drd1 UTSW 13 54053581 missense probably damaging 1.00
R0333:Drd1 UTSW 13 54054063 missense probably damaging 1.00
R1022:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1024:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1397:Drd1 UTSW 13 54053554 missense probably damaging 1.00
R1559:Drd1 UTSW 13 54052945 missense probably damaging 0.99
R1907:Drd1 UTSW 13 54053252 missense possibly damaging 0.88
R2128:Drd1 UTSW 13 54053553 missense probably damaging 1.00
R4913:Drd1 UTSW 13 54053167 missense probably benign 0.33
R5592:Drd1 UTSW 13 54054171 start codon destroyed probably null 0.90
R5867:Drd1 UTSW 13 54054163 missense probably benign
R6758:Drd1 UTSW 13 54053289 missense probably benign
R6966:Drd1 UTSW 13 54053545 missense probably damaging 1.00
R7915:Drd1 UTSW 13 54053815 missense probably damaging 1.00
X0028:Drd1 UTSW 13 54053793 missense probably damaging 1.00
Z1177:Drd1 UTSW 13 54052857 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTAACTGTCCAAAAGCAGCAGAGG -3'
(R):5'- AGACCCAGCCATTCTGCATTGATTC -3'

Sequencing Primer
(F):5'- CCCAATATTCAGGTTGAATGCTGTC -3'
(R):5'- GGCGAATTCCTCCCTGAAC -3'
Posted On2013-07-30