Mutagenetix > Incidental Mutation

Incidental Mutation 'R8041:Ago1'

618512

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R8041 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 126441936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 661 (R661C)

Ref Sequence

ENSEMBL: ENSMUSP00000095498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000097888
AA Change: R661C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: R661C

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

probably damaging
Transcript: ENSMUST00000176315
AA Change: R357C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: R357C

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	G	C	13: 63,033,107	W294C	probably damaging	Het
5830473C10Rik	T	A	5: 90,593,005		probably null	Het
Afap1l1	A	T	18: 61,758,683	L21Q	probably damaging	Het
Aoc3	T	C	11: 101,332,306	V456A	probably benign	Het
Cacna1b	A	T	2: 24,657,299	F1223L	probably damaging	Het
Ccdc40	T	C	11: 119,231,681	F33S	possibly damaging	Het
Ccnjl	T	C	11: 43,579,711	V102A	probably damaging	Het
Cd48	T	C	1: 171,699,390	V128A	probably damaging	Het
Cmah	A	G	13: 24,468,618	D577G	probably benign	Het
Cnnm4	A	G	1: 36,472,093	K134R	probably benign	Het
Cntnap5a	T	A	1: 116,259,479	Y594N	probably damaging	Het
Col14a1	A	G	15: 55,455,230	E1375G	unknown	Het
Comtd1	T	A	14: 21,847,917	E153V	probably benign	Het
Dchs1	T	A	7: 105,755,188	T2716S	probably benign	Het
Ddx4	A	T	13: 112,626,394	S143T	probably benign	Het
Dlg1	A	G	16: 31,838,067	D593G	possibly damaging	Het
Dok6	A	G	18: 89,560,089	I68T	possibly damaging	Het
Dpysl5	A	G	5: 30,796,314	I563V	probably benign	Het
Eapp	A	G	12: 54,692,865	S56P	probably damaging	Het
Fgd5	A	T	6: 92,061,856	D1157V	probably damaging	Het
Fmn1	T	A	2: 113,364,594	L213Q	unknown	Het
Foxo1	T	A	3: 52,345,623	Y402*	probably null	Het
Fyb2	C	A	4: 105,000,484	F619L	possibly damaging	Het
Gm11639	T	G	11: 104,919,479	D3147E	unknown	Het
Gtf2i	A	T	5: 134,293,745		probably null	Het
Hrh1	G	A	6: 114,479,917	R53H	not run	Het
Hydin	A	T	8: 110,574,994	M3786L	probably benign	Het
Ifi207	T	C	1: 173,727,702	R805G	possibly damaging	Het
Igfn1	C	A	1: 135,968,059	G1590*	probably null	Het
Jph3	A	C	8: 121,789,462	I740L	probably benign	Het
Kbtbd7	T	A	14: 79,428,704	F659I	probably benign	Het
Kcns2	A	T	15: 34,839,145	Q218L	probably benign	Het
Kcnt2	A	G	1: 140,609,660	N1119S	probably benign	Het
Krit1	A	T	5: 3,807,309	H38L	probably benign	Het
Krt20	T	A	11: 99,437,837	R87S	probably damaging	Het
Ly6g5c	A	G	17: 35,111,832	E110G	probably damaging	Het
Mamdc4	A	G	2: 25,564,695	F1035S	probably damaging	Het
Mmp13	A	T	9: 7,280,865	D416V	probably benign	Het
Nadk	G	T	4: 155,577,067	D17Y	probably benign	Het
Nrap	A	T	19: 56,364,336	L566*	probably null	Het
Olfr109	T	C	17: 37,466,649	F148L	probably benign	Het
Olfr1271	A	T	2: 90,266,144	C95*	probably null	Het
Olfr494	T	C	7: 108,367,534	F15L	probably damaging	Het
Olfr632	T	C	7: 103,937,581	L67P	probably damaging	Het
Pcdhb19	T	C	18: 37,497,314	L54P	possibly damaging	Het
Pitpnm2	A	G	5: 124,121,456	F1272S	probably damaging	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Reep4	T	C	14: 70,548,187	Y186H	probably benign	Het
Rpgrip1	A	G	14: 52,119,245	T89A	possibly damaging	Het
Shc1	T	C	3: 89,422,953	S175P	probably damaging	Het
Sipa1l3	A	G	7: 29,364,220	S1156P	probably damaging	Het
Slc1a3	G	A	15: 8,636,199	P522L	probably benign	Het
Slc6a17	T	A	3: 107,474,428	T446S	probably damaging	Het
Tas1r2	A	T	4: 139,659,979	N250Y	possibly damaging	Het
Tex15	G	T	8: 33,575,846	R1768L	probably damaging	Het
Ttll9	G	C	2: 153,003,036	Q441H	possibly damaging	Het
Unc5c	T	A	3: 141,465,784	V24E	possibly damaging	Het
Unc79	A	G	12: 103,088,467	E888G	probably benign	Het
Vmn2r19	T	C	6: 123,335,791	S607P	possibly damaging	Het
Vsig1	C	T	X: 140,933,126	H232Y	probably benign	Het
Wdfy4	A	G	14: 33,154,008		probably null	Het
Zbtb49	T	C	5: 38,200,854	D685G	possibly damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R2993:Ago1	UTSW	4	126440046	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTAGGAACACTGAGAACTGTG -3'
(R):5'- TCAGACCCCTTACTTGAGAGC -3'

Sequencing Primer
(F):5'- CTGTGTGCTGAAACAAAAGTCC -3'
(R):5'- GACCCCTTACTTGAGAGCAAAGG -3'

Posted On

2020-01-23