Incidental Mutation 'R8041:Krit1'
ID618515
Institutional Source Beutler Lab
Gene Symbol Krit1
Ensembl Gene ENSMUSG00000000600
Gene NameKRIT1, ankyrin repeat containing
SynonymsKrit1B, A630036P20Rik, Krit1, Krit1A, Ccm1, 2010007K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location3803184-3845564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3807309 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 38 (H38L)
Ref Sequence ENSEMBL: ENSMUSP00000078985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000080085] [ENSMUST00000171023] [ENSMUST00000198079] [ENSMUST00000200386] [ENSMUST00000200577]
Predicted Effect probably benign
Transcript: ENSMUST00000043551
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080085
AA Change: H38L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078985
Gene: ENSMUSG00000000600
AA Change: H38L

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 3.8e-88 PFAM
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Blast:B41 673 702 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171023
AA Change: H38L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132375
Gene: ENSMUSG00000000600
AA Change: H38L

DomainStartEndE-ValueType
PDB:4DX8|K 1 198 1e-125 PDB
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198079
AA Change: H58L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142657
Gene: ENSMUSG00000000600
AA Change: H58L

DomainStartEndE-ValueType
PDB:4DX8|K 20 132 4e-62 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200386
AA Change: H38L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143559
Gene: ENSMUSG00000000600
AA Change: H38L

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 8.1e-85 PFAM
ANK 306 334 7.5e-4 SMART
B41 368 592 9.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200577
AA Change: H38L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143776
Gene: ENSMUSG00000000600
AA Change: H38L

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 1.8e-85 PFAM
Blast:B41 200 329 1e-82 BLAST
SCOP:d1ycsb1 291 329 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality by E11. Embryos display prominent vascular defects that disrupt arterial modeling and phenocopy the human disorder of cerebral cavernous malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Krit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Krit1 APN 5 3812844 missense probably damaging 0.98
IGL02186:Krit1 APN 5 3809733 splice site probably benign
IGL02526:Krit1 APN 5 3822103 missense probably damaging 1.00
IGL03280:Krit1 APN 5 3811248 splice site probably benign
IGL03385:Krit1 APN 5 3807452 missense possibly damaging 0.51
Waspish UTSW 5 3831551 missense probably damaging 1.00
R0127:Krit1 UTSW 5 3822178 missense probably damaging 0.99
R0594:Krit1 UTSW 5 3823694 missense possibly damaging 0.71
R1157:Krit1 UTSW 5 3832176 missense probably damaging 1.00
R1777:Krit1 UTSW 5 3836799 missense probably damaging 0.96
R2115:Krit1 UTSW 5 3822108 nonsense probably null
R4021:Krit1 UTSW 5 3832132 missense probably benign 0.21
R4041:Krit1 UTSW 5 3809642 missense probably damaging 1.00
R4786:Krit1 UTSW 5 3812467 missense possibly damaging 0.86
R4989:Krit1 UTSW 5 3822238 missense probably damaging 1.00
R5217:Krit1 UTSW 5 3806451 nonsense probably null
R5304:Krit1 UTSW 5 3819326 missense probably damaging 0.99
R5371:Krit1 UTSW 5 3831551 missense probably damaging 1.00
R5682:Krit1 UTSW 5 3830737 missense probably damaging 0.99
R6248:Krit1 UTSW 5 3813032 splice site probably null
R6338:Krit1 UTSW 5 3836857 missense probably benign 0.01
R7081:Krit1 UTSW 5 3823651 missense possibly damaging 0.71
R7454:Krit1 UTSW 5 3812474 missense probably damaging 0.99
R7497:Krit1 UTSW 5 3812349 missense possibly damaging 0.93
R7684:Krit1 UTSW 5 3830723 missense possibly damaging 0.75
R7780:Krit1 UTSW 5 3812772 missense probably damaging 1.00
R7862:Krit1 UTSW 5 3812788 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTTTGTAATGTTATCCTAAGCC -3'
(R):5'- ACAACTTCCTGAGGTTTTCATACTC -3'

Sequencing Primer
(F):5'- CGATTGACTTGGGAAACTACTAGTGC -3'
(R):5'- CCTGGTCTACATAATGAGTTCCAGG -3'
Posted On2020-01-23