Incidental Mutation 'R8041:Dpysl5'
ID618516
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Namedihydropyrimidinase-like 5
SynonymsCRAM, CRMP-5, Crmp5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30711564-30799375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30796314 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 563 (I563V)
Ref Sequence ENSEMBL: ENSMUSP00000085400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
Predicted Effect probably benign
Transcript: ENSMUST00000088081
AA Change: I563V

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: I563V

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114729
AA Change: I563V

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: I563V

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30745278 missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30788781 missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30778066 missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30788841 critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30777994 missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30791597 missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30792268 missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30784343 missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30792268 missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30791513 missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30777973 critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30784469 critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30783195 missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30792298 missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30745461 missense probably benign
R7446:Dpysl5 UTSW 5 30778887 missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30745416 missense probably damaging 1.00
R8428:Dpysl5 UTSW 5 30745467 missense probably damaging 0.99
Z1176:Dpysl5 UTSW 5 30778120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACACTCGCAGAAGGTTTAAC -3'
(R):5'- CAGCTCAAAGTGCCTTGTTAGG -3'

Sequencing Primer
(F):5'- AGGTTTAACTCAGCCACTGG -3'
(R):5'- GTGGATCAAAGCCCCGTGAATC -3'
Posted On2020-01-23