Incidental Mutation 'R8041:5830473C10Rik'
ID618518
Institutional Source Beutler Lab
Gene Symbol 5830473C10Rik
Ensembl Gene ENSMUSG00000070690
Gene NameRIKEN cDNA 5830473C10 gene
SynonymsGm17754, ARG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location90561107-90597871 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 90593005 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094615]
Predicted Effect probably null
Transcript: ENSMUST00000094615
SMART Domains Protein: ENSMUSP00000092198
Gene: ENSMUSG00000070690

DomainStartEndE-ValueType
ALBUMIN 17 207 8.87e-26 SMART
ALBUMIN 214 399 1.45e-53 SMART
ALBUMIN 406 598 7.07e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in 5830473C10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:5830473C10Rik APN 5 90579579 unclassified probably benign
IGL02343:5830473C10Rik APN 5 90579614 missense probably damaging 0.99
IGL02749:5830473C10Rik APN 5 90571765 missense possibly damaging 0.84
IGL02956:5830473C10Rik APN 5 90579638 missense possibly damaging 0.46
R0097:5830473C10Rik UTSW 5 90584936 missense probably benign 0.02
R0097:5830473C10Rik UTSW 5 90584936 missense probably benign 0.02
R0513:5830473C10Rik UTSW 5 90577927 missense probably benign 0.00
R0551:5830473C10Rik UTSW 5 90572719 missense probably damaging 1.00
R1508:5830473C10Rik UTSW 5 90581921 missense probably benign 0.00
R1797:5830473C10Rik UTSW 5 90579601 missense probably damaging 0.99
R2205:5830473C10Rik UTSW 5 90569562 missense possibly damaging 0.50
R2323:5830473C10Rik UTSW 5 90584852 nonsense probably null
R2440:5830473C10Rik UTSW 5 90572689 critical splice acceptor site probably null
R4074:5830473C10Rik UTSW 5 90592868 splice site probably null
R4211:5830473C10Rik UTSW 5 90564237 missense probably damaging 1.00
R4426:5830473C10Rik UTSW 5 90572783 missense probably damaging 1.00
R4625:5830473C10Rik UTSW 5 90571752 missense probably damaging 0.99
R4823:5830473C10Rik UTSW 5 90566503 missense probably benign 0.01
R4922:5830473C10Rik UTSW 5 90579711 missense possibly damaging 0.84
R4923:5830473C10Rik UTSW 5 90561299 missense probably benign 0.07
R5218:5830473C10Rik UTSW 5 90581918 missense probably benign 0.34
R5267:5830473C10Rik UTSW 5 90584857 missense probably damaging 0.99
R5447:5830473C10Rik UTSW 5 90584310 missense probably damaging 1.00
R5737:5830473C10Rik UTSW 5 90572783 missense probably damaging 1.00
R5966:5830473C10Rik UTSW 5 90571687 missense probably damaging 1.00
R6045:5830473C10Rik UTSW 5 90584989 missense possibly damaging 0.86
R6290:5830473C10Rik UTSW 5 90593005 critical splice donor site probably null
R6799:5830473C10Rik UTSW 5 90579615 missense probably damaging 0.99
R6923:5830473C10Rik UTSW 5 90577793 missense probably benign 0.32
R7088:5830473C10Rik UTSW 5 90572750 nonsense probably null
R7238:5830473C10Rik UTSW 5 90579660 missense probably damaging 1.00
R7319:5830473C10Rik UTSW 5 90571766 critical splice donor site probably null
R7631:5830473C10Rik UTSW 5 90579672 missense probably damaging 1.00
R7798:5830473C10Rik UTSW 5 90597511 missense possibly damaging 0.72
R7821:5830473C10Rik UTSW 5 90592888 missense possibly damaging 0.95
R8353:5830473C10Rik UTSW 5 90566501 missense possibly damaging 0.67
R8453:5830473C10Rik UTSW 5 90566501 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGGCCTTGCAAACTCAGGAG -3'
(R):5'- CTGGCACCAGAGTTATTGTGTC -3'

Sequencing Primer
(F):5'- GCCTTGCAAACTCAGGAGCTAATAC -3'
(R):5'- GAGTCTTCCAGTTTCTCCAAACATAC -3'
Posted On2020-01-23