Incidental Mutation 'R8041:Sipa1l3'
ID618524
Institutional Source Beutler Lab
Gene Symbol Sipa1l3
Ensembl Gene ENSMUSG00000030583
Gene Namesignal-induced proliferation-associated 1 like 3
Synonyms2610511M17Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001081028.1; MGI: 1921456

Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29320372-29518641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29364220 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1156 (S1156P)
Ref Sequence ENSEMBL: ENSMUSP00000082965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085809] [ENSMUST00000182484] [ENSMUST00000183096] [ENSMUST00000183275]
Predicted Effect probably damaging
Transcript: ENSMUST00000085809
AA Change: S1156P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583
AA Change: S1156P

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 816 1.7e-68 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:SPAR_C 1471 1721 1.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182484
AA Change: S107P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138714
Gene: ENSMUSG00000030583
AA Change: S107P

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
Pfam:DUF3401 422 671 2.7e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183096
AA Change: S1156P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583
AA Change: S1156P

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 822 6.7e-64 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:DUF3401 1471 1721 7.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183275
Predicted Effect probably benign
Transcript: ENSMUST00000183330
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the signal induced proliferation associated 1 family of genes, which encode GTPase-activating proteins specific for the GTP-binding protein Rap1. Rap1 has been implicated in regulation of cell adhesion, cell polarity, and organization of the cytoskeleton. Like other members of the family, the protein encoded by this gene contains RapGAP and PDZ domains. In addition, this protein contains a C-terminal leucine zipper domain. This gene is proposed to function in epithelial cell morphogenesis and establishment or maintenance of polarity. Consistently, expression of the protein in cell culture showed localization to cell-cell borders in apical regions, and downregulation of the gene in 3D Caco2 cell culture resulted in abnormal cell polarity and morphogenesis. Allelic variants of this gene have been associated with congenital cataracts in humans. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small lenses, microphthalmia, cataracts, posterior iris synechia, and abnormal lens fiber morphology. [provided by MGI curators]
Allele List at MGI

All alleles(486) : Gene trapped(486)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Sipa1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Sipa1l3 APN 7 29354133 missense probably damaging 0.97
IGL00481:Sipa1l3 APN 7 29386108 missense probably damaging 0.99
IGL01071:Sipa1l3 APN 7 29324220 missense possibly damaging 0.88
IGL01300:Sipa1l3 APN 7 29399828 nonsense probably null
IGL01361:Sipa1l3 APN 7 29348687 missense probably damaging 1.00
IGL01380:Sipa1l3 APN 7 29331372 missense possibly damaging 0.94
IGL02083:Sipa1l3 APN 7 29387261 missense probably damaging 1.00
IGL02484:Sipa1l3 APN 7 29399531 missense probably damaging 1.00
IGL02542:Sipa1l3 APN 7 29388065 missense probably damaging 1.00
IGL02645:Sipa1l3 APN 7 29328980 splice site probably null
IGL03410:Sipa1l3 APN 7 29348539 missense probably damaging 1.00
P0014:Sipa1l3 UTSW 7 29383215 missense probably damaging 1.00
R0111:Sipa1l3 UTSW 7 29348318 missense probably damaging 0.99
R0309:Sipa1l3 UTSW 7 29348350 missense probably benign 0.01
R0554:Sipa1l3 UTSW 7 29388030 missense possibly damaging 0.90
R0624:Sipa1l3 UTSW 7 29387251 missense probably damaging 1.00
R0894:Sipa1l3 UTSW 7 29387291 nonsense probably null
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1550:Sipa1l3 UTSW 7 29383203 missense probably benign 0.00
R1850:Sipa1l3 UTSW 7 29339126 missense probably damaging 0.96
R1905:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1907:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1994:Sipa1l3 UTSW 7 29399611 missense probably benign 0.39
R2228:Sipa1l3 UTSW 7 29377939 nonsense probably null
R2267:Sipa1l3 UTSW 7 29399602 missense probably damaging 1.00
R2341:Sipa1l3 UTSW 7 29377635 missense probably damaging 0.98
R3914:Sipa1l3 UTSW 7 29400085 missense probably benign 0.28
R4197:Sipa1l3 UTSW 7 29400813 missense possibly damaging 0.81
R4559:Sipa1l3 UTSW 7 29332253 missense probably damaging 1.00
R4569:Sipa1l3 UTSW 7 29325862 missense probably damaging 1.00
R4783:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4784:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4785:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4823:Sipa1l3 UTSW 7 29371002 missense probably damaging 1.00
R5057:Sipa1l3 UTSW 7 29371193 missense probably damaging 1.00
R5084:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5085:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5086:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5918:Sipa1l3 UTSW 7 29397206 missense probably damaging 1.00
R5973:Sipa1l3 UTSW 7 29399524 missense probably benign 0.20
R6291:Sipa1l3 UTSW 7 29388133 missense probably damaging 1.00
R6299:Sipa1l3 UTSW 7 29366549 critical splice donor site probably null
R6828:Sipa1l3 UTSW 7 29339032 missense probably benign 0.17
R6914:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R6942:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R7102:Sipa1l3 UTSW 7 29348587 missense possibly damaging 0.74
R7225:Sipa1l3 UTSW 7 29399428 missense probably damaging 1.00
R7310:Sipa1l3 UTSW 7 29399696 missense probably benign
R7429:Sipa1l3 UTSW 7 29387206 missense probably benign 0.24
R7489:Sipa1l3 UTSW 7 29366702 missense probably damaging 1.00
R7789:Sipa1l3 UTSW 7 29377725 missense probably damaging 1.00
R7923:Sipa1l3 UTSW 7 29339146 nonsense probably null
R8245:Sipa1l3 UTSW 7 29400364 missense probably damaging 1.00
Z1177:Sipa1l3 UTSW 7 29400434 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTGCCAATACCCTGGTGG -3'
(R):5'- AGAACCTGGCTGGACTTGAAG -3'

Sequencing Primer
(F):5'- CCTGGTGGTCGTTTTCTGACC -3'
(R):5'- AAGGGCAGGTGTGTTGTATACCTC -3'
Posted On2020-01-23