Incidental Mutation 'R8041:Pml'
ID618532
Institutional Source Beutler Lab
Gene Symbol Pml
Ensembl Gene ENSMUSG00000036986
Gene Namepromyelocytic leukemia
SynonymsTrim19, 1200009E24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8041 (G1)
Quality Score171.009
Status Not validated
Chromosome9
Chromosomal Location58218076-58249786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58234685 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 288 (R288L)
Ref Sequence ENSEMBL: ENSMUSP00000082816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085673] [ENSMUST00000114136] [ENSMUST00000124063] [ENSMUST00000135310] [ENSMUST00000148301] [ENSMUST00000153820]
Predicted Effect probably benign
Transcript: ENSMUST00000085673
AA Change: R288L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082816
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 5e-7 BLAST
Pfam:DUF3583 244 580 4e-166 PFAM
Blast:EXOIII 619 762 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114136
AA Change: R288L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109771
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 434 5.5e-109 PFAM
Pfam:DUF3583 428 535 1.4e-57 PFAM
Blast:EXOIII 573 716 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124063
SMART Domains Protein: ENSMUSP00000118232
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116787
Gene: ENSMUSG00000036986
AA Change: R279L

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
RING 54 88 1.83e-3 SMART
BBOX 121 163 4.99e-5 SMART
Blast:BBOX 181 225 4e-7 BLAST
Pfam:DUF3583 236 422 1.4e-89 PFAM
Pfam:DUF3583 411 526 2.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135310
AA Change: R288L

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122854
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 8.8e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148301
SMART Domains Protein: ENSMUSP00000120620
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153820
AA Change: R288L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118955
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 9.2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene have an increased susceptibility to infection and to induction of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Pml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Pml APN 9 58247003 missense probably benign 0.04
IGL03147:Pml UTSW 9 58230043 missense possibly damaging 0.85
R0019:Pml UTSW 9 58220493 missense probably damaging 1.00
R0905:Pml UTSW 9 58249539 critical splice donor site probably null
R1171:Pml UTSW 9 58234538 missense probably damaging 1.00
R2189:Pml UTSW 9 58234874 missense probably benign 0.00
R2330:Pml UTSW 9 58234571 missense probably damaging 1.00
R2909:Pml UTSW 9 58247243 missense possibly damaging 0.75
R4749:Pml UTSW 9 58234652 missense probably damaging 0.99
R5228:Pml UTSW 9 58219997 missense probably damaging 1.00
R5300:Pml UTSW 9 58247019 missense probably damaging 1.00
R5669:Pml UTSW 9 58247063 missense probably benign 0.00
R5876:Pml UTSW 9 58233182 missense possibly damaging 0.71
R6854:Pml UTSW 9 58219906 missense probably damaging 0.99
R6996:Pml UTSW 9 58234886 missense probably damaging 1.00
R7387:Pml UTSW 9 58229894 missense probably benign 0.08
R7448:Pml UTSW 9 58247213 missense probably benign 0.27
R7762:Pml UTSW 9 58220173 missense probably damaging 1.00
R7833:Pml UTSW 9 58234685 missense probably benign 0.15
R7834:Pml UTSW 9 58234685 missense probably benign 0.15
R7903:Pml UTSW 9 58249584 missense probably benign 0.01
R7916:Pml UTSW 9 58234685 missense probably benign 0.15
R7917:Pml UTSW 9 58234685 missense probably benign 0.15
R7986:Pml UTSW 9 58249584 missense probably benign 0.01
R8040:Pml UTSW 9 58234685 missense probably benign 0.15
R8042:Pml UTSW 9 58234685 missense probably benign 0.15
R8046:Pml UTSW 9 58246973 critical splice donor site probably null
R8284:Pml UTSW 9 58229360 missense probably benign 0.15
Z1088:Pml UTSW 9 58234590 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGCTACAGAGTGCCTTGC -3'
(R):5'- CCATCTCCATTGCGATATTGGTG -3'

Sequencing Primer
(F):5'- CGCAGAAAGCTGTGCATATC -3'
(R):5'- CGATATTGGTGAGGAGATTCAGC -3'
Posted On2020-01-23