Incidental Mutation 'R0661:Msh3'
ID61854
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R0661 (G1)
Quality Score111
Status Not validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92345096 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 303 (N303D)
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022220
AA Change: N303D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: N303D

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185852
AA Change: N303D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: N303D

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187831
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189376
Predicted Effect probably benign
Transcript: ENSMUST00000190393
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
R7586:Msh3 UTSW 13 92349332 utr 3 prime probably benign
R7641:Msh3 UTSW 13 92212503 missense probably benign 0.08
R7648:Msh3 UTSW 13 92274028 missense probably damaging 1.00
R7674:Msh3 UTSW 13 92212503 missense probably benign 0.08
R8125:Msh3 UTSW 13 92299182 missense probably benign
R8252:Msh3 UTSW 13 92221061 missense probably damaging 1.00
R8388:Msh3 UTSW 13 92223276 missense probably damaging 1.00
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCACCTTCCAAGGACTTACCACG -3'
(R):5'- GGTTGTTAAGGAGTCAAGTGCCACG -3'

Sequencing Primer
(F):5'- ACGATACCAACGGAAAGGTTC -3'
(R):5'- TCCCACATGGTTGCAGGTG -3'
Posted On2013-07-30