Incidental Mutation 'R8041:Ddx4'
ID618542
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
SynonymsMvh, VASA, mvh / m'vasa
MMRRC Submission
Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location112598333-112652475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112626394 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 143 (S143T)
Ref Sequence ENSEMBL: ENSMUSP00000096769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
Predicted Effect probably benign
Transcript: ENSMUST00000075748
AA Change: S117T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: S117T

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099166
AA Change: S143T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: S143T

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Dlg1 A G 16: 31,838,067 D593G possibly damaging Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112624777 splice site probably benign
IGL02682:Ddx4 APN 13 112622186 missense probably benign 0.04
IGL02729:Ddx4 APN 13 112651412 utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112613833 splice site probably null
R0518:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R0521:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R1527:Ddx4 UTSW 13 112622239 missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112599997 missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112599902 missense probably benign
R1886:Ddx4 UTSW 13 112622665 missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112620742 missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112621276 missense probably benign 0.08
R2280:Ddx4 UTSW 13 112620656 missense probably benign 0.03
R2846:Ddx4 UTSW 13 112604612 missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112620777 splice site probably benign
R2980:Ddx4 UTSW 13 112612085 missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112611982 missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4088:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4089:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4090:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4600:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112622244 missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112613696 critical splice donor site probably null
R4782:Ddx4 UTSW 13 112651360 missense probably benign 0.10
R5326:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112621232 nonsense probably null
R6253:Ddx4 UTSW 13 112636022 nonsense probably null
R6253:Ddx4 UTSW 13 112636023 missense probably benign 0.00
R6286:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112604547 missense probably benign
R6645:Ddx4 UTSW 13 112641174 missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112601488 missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112613785 missense probably benign 0.01
R7822:Ddx4 UTSW 13 112612113 missense probably damaging 1.00
R7921:Ddx4 UTSW 13 112601507 missense probably benign
R8048:Ddx4 UTSW 13 112622172 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTAACTTGTCTGCTACTCTAC -3'
(R):5'- TCAGTTTTGAGTCTTCAATGCC -3'

Sequencing Primer
(F):5'- ACTTGGTCTTCCTAGACC -3'
(R):5'- TCCATTACCATGTCTCCAA -3'
Posted On2020-01-23