Incidental Mutation 'R8041:Dlg1'
ID618551
Institutional Source Beutler Lab
Gene Symbol Dlg1
Ensembl Gene ENSMUSG00000022770
Gene Namediscs large MAGUK scaffold protein 1
SynonymsDlgh1, B130052P05Rik, SAP97
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8041 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location31663443-31875129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31838067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 593 (D593G)
Ref Sequence ENSEMBL: ENSMUSP00000064280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023454] [ENSMUST00000064477] [ENSMUST00000100001] [ENSMUST00000115196] [ENSMUST00000115201] [ENSMUST00000115205] [ENSMUST00000132176]
Predicted Effect probably damaging
Transcript: ENSMUST00000023454
AA Change: D560G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023454
Gene: ENSMUSG00000022770
AA Change: D560G

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 441 514 1.84e-22 SMART
low complexity region 534 542 N/A INTRINSIC
SH3 551 617 1.27e-9 SMART
GuKc 681 860 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000064477
AA Change: D593G

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064280
Gene: ENSMUSG00000022770
AA Change: D593G

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 736 915 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100001
AA Change: D593G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097581
Gene: ENSMUSG00000022770
AA Change: D593G

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115196
AA Change: D510G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110850
Gene: ENSMUSG00000022770
AA Change: D510G

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
MAGUK_N_PEST 30 140 1.81e-14 SMART
PDZ 149 228 5.98e-22 SMART
PDZ 244 323 1.94e-21 SMART
PDZ 391 464 1.84e-22 SMART
low complexity region 484 492 N/A INTRINSIC
SH3 501 567 1.27e-9 SMART
GuKc 643 822 1.54e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115201
AA Change: D593G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110855
Gene: ENSMUSG00000022770
AA Change: D593G

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 721 900 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115205
AA Change: D593G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110859
Gene: ENSMUSG00000022770
AA Change: D593G

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect
Predicted Effect
SMART Domains Protein: ENSMUSP00000115954
Gene: ENSMUSG00000022770
AA Change: D288G

DomainStartEndE-ValueType
PDZ 38 117 1.94e-21 SMART
PDZ 170 243 1.84e-22 SMART
low complexity region 263 271 N/A INTRINSIC
SH3 280 346 1.27e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132176
AA Change: T547A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138782
Gene: ENSMUSG00000022770
AA Change: T547A

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 426 499 1.84e-22 SMART
low complexity region 519 527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain scaffolding protein that is required for normal development. This protein may have a role in septate junction formation, signal transduction, cell proliferation, synaptogenesis and lymphocyte activation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene, but the full-length nature of some of the variants is not known. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal lethality, craniofacial defects, and abnormal eye morphology. Mice homozygous for knock-out alleles exhibit neonatal lethality, kidney defects, reproductive organ morphology, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G C 13: 63,033,107 W294C probably damaging Het
5830473C10Rik T A 5: 90,593,005 probably null Het
Afap1l1 A T 18: 61,758,683 L21Q probably damaging Het
Ago1 G A 4: 126,441,936 R661C probably damaging Het
Aoc3 T C 11: 101,332,306 V456A probably benign Het
Cacna1b A T 2: 24,657,299 F1223L probably damaging Het
Ccdc40 T C 11: 119,231,681 F33S possibly damaging Het
Ccnjl T C 11: 43,579,711 V102A probably damaging Het
Cd48 T C 1: 171,699,390 V128A probably damaging Het
Cmah A G 13: 24,468,618 D577G probably benign Het
Cnnm4 A G 1: 36,472,093 K134R probably benign Het
Cntnap5a T A 1: 116,259,479 Y594N probably damaging Het
Col14a1 A G 15: 55,455,230 E1375G unknown Het
Comtd1 T A 14: 21,847,917 E153V probably benign Het
Dchs1 T A 7: 105,755,188 T2716S probably benign Het
Ddx4 A T 13: 112,626,394 S143T probably benign Het
Dok6 A G 18: 89,560,089 I68T possibly damaging Het
Dpysl5 A G 5: 30,796,314 I563V probably benign Het
Eapp A G 12: 54,692,865 S56P probably damaging Het
Fgd5 A T 6: 92,061,856 D1157V probably damaging Het
Fmn1 T A 2: 113,364,594 L213Q unknown Het
Foxo1 T A 3: 52,345,623 Y402* probably null Het
Fyb2 C A 4: 105,000,484 F619L possibly damaging Het
Gm11639 T G 11: 104,919,479 D3147E unknown Het
Gtf2i A T 5: 134,293,745 probably null Het
Hrh1 G A 6: 114,479,917 R53H not run Het
Hydin A T 8: 110,574,994 M3786L probably benign Het
Ifi207 T C 1: 173,727,702 R805G possibly damaging Het
Igfn1 C A 1: 135,968,059 G1590* probably null Het
Jph3 A C 8: 121,789,462 I740L probably benign Het
Kbtbd7 T A 14: 79,428,704 F659I probably benign Het
Kcns2 A T 15: 34,839,145 Q218L probably benign Het
Kcnt2 A G 1: 140,609,660 N1119S probably benign Het
Krit1 A T 5: 3,807,309 H38L probably benign Het
Krt20 T A 11: 99,437,837 R87S probably damaging Het
Ly6g5c A G 17: 35,111,832 E110G probably damaging Het
Mamdc4 A G 2: 25,564,695 F1035S probably damaging Het
Mmp13 A T 9: 7,280,865 D416V probably benign Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nrap A T 19: 56,364,336 L566* probably null Het
Olfr109 T C 17: 37,466,649 F148L probably benign Het
Olfr1271 A T 2: 90,266,144 C95* probably null Het
Olfr494 T C 7: 108,367,534 F15L probably damaging Het
Olfr632 T C 7: 103,937,581 L67P probably damaging Het
Pcdhb19 T C 18: 37,497,314 L54P possibly damaging Het
Pitpnm2 A G 5: 124,121,456 F1272S probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Reep4 T C 14: 70,548,187 Y186H probably benign Het
Rpgrip1 A G 14: 52,119,245 T89A possibly damaging Het
Shc1 T C 3: 89,422,953 S175P probably damaging Het
Sipa1l3 A G 7: 29,364,220 S1156P probably damaging Het
Slc1a3 G A 15: 8,636,199 P522L probably benign Het
Slc6a17 T A 3: 107,474,428 T446S probably damaging Het
Tas1r2 A T 4: 139,659,979 N250Y possibly damaging Het
Tex15 G T 8: 33,575,846 R1768L probably damaging Het
Ttll9 G C 2: 153,003,036 Q441H possibly damaging Het
Unc5c T A 3: 141,465,784 V24E possibly damaging Het
Unc79 A G 12: 103,088,467 E888G probably benign Het
Vmn2r19 T C 6: 123,335,791 S607P possibly damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdfy4 A G 14: 33,154,008 probably null Het
Zbtb49 T C 5: 38,200,854 D685G possibly damaging Het
Other mutations in Dlg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Dlg1 APN 16 31856438 splice site probably benign
IGL02277:Dlg1 APN 16 31790264 missense probably damaging 1.00
IGL02897:Dlg1 APN 16 31771856 critical splice donor site probably null
IGL03025:Dlg1 APN 16 31805727 missense probably benign 0.00
IGL03271:Dlg1 APN 16 31857892 missense possibly damaging 0.94
PIT4812001:Dlg1 UTSW 16 31846885 missense probably benign 0.01
R0068:Dlg1 UTSW 16 31836200 unclassified probably benign
R0115:Dlg1 UTSW 16 31805690 nonsense probably null
R0128:Dlg1 UTSW 16 31858065 critical splice donor site probably null
R0257:Dlg1 UTSW 16 31842853 splice site probably benign
R0268:Dlg1 UTSW 16 31684193 missense probably benign
R0312:Dlg1 UTSW 16 31790267 missense probably benign
R0321:Dlg1 UTSW 16 31858036 missense probably damaging 1.00
R0355:Dlg1 UTSW 16 31684174 nonsense probably null
R0538:Dlg1 UTSW 16 31796864 critical splice acceptor site probably null
R0540:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0607:Dlg1 UTSW 16 31665580 missense probably benign 0.37
R0607:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0894:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R1107:Dlg1 UTSW 16 31846916 missense probably benign 0.00
R1349:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1372:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1696:Dlg1 UTSW 16 31781798 missense probably damaging 0.96
R1772:Dlg1 UTSW 16 31665667 missense possibly damaging 0.75
R1795:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R2106:Dlg1 UTSW 16 31812756 missense probably damaging 1.00
R2206:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2207:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2846:Dlg1 UTSW 16 31863197 missense probably damaging 1.00
R3954:Dlg1 UTSW 16 31858008 missense probably damaging 1.00
R4714:Dlg1 UTSW 16 31790261 missense probably damaging 1.00
R4758:Dlg1 UTSW 16 31791752 missense possibly damaging 0.92
R4898:Dlg1 UTSW 16 31857946 missense probably damaging 1.00
R4964:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4966:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4985:Dlg1 UTSW 16 31788135 splice site probably null
R5068:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5069:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5078:Dlg1 UTSW 16 31856469 nonsense probably null
R5090:Dlg1 UTSW 16 31838084 missense probably damaging 1.00
R5225:Dlg1 UTSW 16 31836267 missense probably benign 0.21
R5888:Dlg1 UTSW 16 31791886 critical splice donor site probably null
R5950:Dlg1 UTSW 16 31665583 missense probably damaging 1.00
R6029:Dlg1 UTSW 16 31793570 missense probably damaging 1.00
R6132:Dlg1 UTSW 16 31836241 missense possibly damaging 0.93
R6246:Dlg1 UTSW 16 31665650 missense probably benign 0.00
R6294:Dlg1 UTSW 16 31838124 missense probably damaging 1.00
R6322:Dlg1 UTSW 16 31856479 missense probably damaging 1.00
R7147:Dlg1 UTSW 16 31791854 missense probably benign
R7216:Dlg1 UTSW 16 31796918 frame shift probably null
R7963:Dlg1 UTSW 16 31790301 missense probably null 0.92
R7985:Dlg1 UTSW 16 31788105 nonsense probably null
R8111:Dlg1 UTSW 16 31842802 missense possibly damaging 0.79
X0021:Dlg1 UTSW 16 31665708 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATGCAGTCTATCCTAAAACACTG -3'
(R):5'- AACACCATGTACCTTCGTTTACTAG -3'

Sequencing Primer
(F):5'- CTTAGACTGTTTCCATTACAGAGTG -3'
(R):5'- GGAATCACTCCGACTTCGTCAC -3'
Posted On2020-01-23