Incidental Mutation 'R8042:Stam2'
ID618563
Institutional Source Beutler Lab
Gene Symbol Stam2
Ensembl Gene ENSMUSG00000055371
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 2
SynonymsHbp, 1200004O12Rik, 5730456G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location52691664-52742281 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 52706397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102759] [ENSMUST00000127316] [ENSMUST00000155516]
Predicted Effect probably null
Transcript: ENSMUST00000102759
SMART Domains Protein: ENSMUSP00000099820
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
VHS 9 140 6.36e-57 SMART
UIM 165 184 3.24e-3 SMART
SH3 205 260 5.69e-21 SMART
Pfam:GAT 294 367 2.3e-8 PFAM
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127316
SMART Domains Protein: ENSMUSP00000121898
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
Pfam:VHS 4 70 8.5e-20 PFAM
UIM 132 151 3.24e-3 SMART
SH3 172 227 5.69e-21 SMART
PDB:3F1I|C 258 334 4e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155516
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal lymphocyte responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Stam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Stam2 APN 2 52706406 missense possibly damaging 0.80
IGL00471:Stam2 APN 2 52720935 missense probably damaging 1.00
IGL01480:Stam2 APN 2 52716439 missense probably benign
IGL01731:Stam2 APN 2 52708150 missense probably damaging 0.99
IGL02684:Stam2 APN 2 52719935 missense probably damaging 1.00
IGL02893:Stam2 APN 2 52714902 missense probably damaging 1.00
IGL02900:Stam2 APN 2 52708197 missense probably benign
R0110:Stam2 UTSW 2 52719986 splice site probably benign
R0257:Stam2 UTSW 2 52694782 missense possibly damaging 0.90
R0539:Stam2 UTSW 2 52703256 splice site probably benign
R1432:Stam2 UTSW 2 52714809 splice site probably benign
R1699:Stam2 UTSW 2 52703175 missense possibly damaging 0.55
R1822:Stam2 UTSW 2 52716527 missense probably damaging 1.00
R1956:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R1984:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1985:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1986:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1993:Stam2 UTSW 2 52703156 nonsense probably null
R2179:Stam2 UTSW 2 52694924 missense probably benign 0.00
R2181:Stam2 UTSW 2 52703144 missense probably benign 0.00
R4617:Stam2 UTSW 2 52715704 missense probably benign 0.00
R4723:Stam2 UTSW 2 52720950 missense probably benign 0.10
R5217:Stam2 UTSW 2 52736293 intron probably benign
R5218:Stam2 UTSW 2 52736293 intron probably benign
R5219:Stam2 UTSW 2 52736293 intron probably benign
R5366:Stam2 UTSW 2 52736293 intron probably benign
R5368:Stam2 UTSW 2 52736293 intron probably benign
R5420:Stam2 UTSW 2 52736293 intron probably benign
R5447:Stam2 UTSW 2 52736293 intron probably benign
R5490:Stam2 UTSW 2 52720917 missense probably damaging 1.00
R5799:Stam2 UTSW 2 52720910 nonsense probably null
R5861:Stam2 UTSW 2 52742104 utr 5 prime probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6490:Stam2 UTSW 2 52720942 missense probably benign 0.00
R6552:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R6792:Stam2 UTSW 2 52707981 missense probably benign
R7787:Stam2 UTSW 2 52706406 missense probably benign 0.01
R8050:Stam2 UTSW 2 52719773 missense probably damaging 1.00
R8074:Stam2 UTSW 2 52706426 missense probably damaging 0.98
R8245:Stam2 UTSW 2 52714919 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGCAAGGGTCCACGGTTATATAC -3'
(R):5'- GACCTTGACTCTGGTCTGTG -3'

Sequencing Primer
(F):5'- GGGTCCACGGTTATATACATATCAC -3'
(R):5'- TGTCATCTTTCCCCAGCATAAG -3'
Posted On2020-01-23