Incidental Mutation 'R8042:Errfi1'
ID618565
Institutional Source Beutler Lab
Gene Symbol Errfi1
Ensembl Gene ENSMUSG00000028967
Gene NameERBB receptor feedback inhibitor 1
SynonymsMig-6, RALT, 1300002F13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location150853919-150868892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150866457 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 114 (F114S)
Ref Sequence ENSEMBL: ENSMUSP00000030811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030811] [ENSMUST00000073600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030811
AA Change: F114S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030811
Gene: ENSMUSG00000028967
AA Change: F114S

DomainStartEndE-ValueType
Pfam:GTPase_binding 4 67 5.5e-40 PFAM
low complexity region 171 186 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 279 295 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 314 370 9.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073600
AA Change: F114S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073285
Gene: ENSMUSG00000028967
AA Change: F114S

DomainStartEndE-ValueType
Pfam:GTPase_binding 4 67 4.1e-36 PFAM
low complexity region 171 186 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 279 295 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 314 371 6.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ERRFI1 is a cytoplasmic protein whose expression is upregulated with cell growth (Wick et al., 1995 [PubMed 7641805]). It shares significant homology with the protein product of rat gene-33, which is induced during cell stress and mediates cell signaling (Makkinje et al., 2000 [PubMed 10749885]; Fiorentino et al., 2000 [PubMed 11003669]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to premature death, delayed eyelid opening, epidermal hyperplasia, degenerative joint disease, skin or lung cancer, gastrointestinal tract tumors, increased susceptibility to chemically-induced tumors, and impaired lung development and vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Errfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Errfi1 APN 4 150867030 missense probably damaging 0.99
IGL02425:Errfi1 APN 4 150866356 missense probably benign 0.01
R1326:Errfi1 UTSW 4 150865164 missense possibly damaging 0.92
R1530:Errfi1 UTSW 4 150865386 missense probably benign 0.36
R3162:Errfi1 UTSW 4 150867359 missense probably damaging 1.00
R3162:Errfi1 UTSW 4 150867359 missense probably damaging 1.00
R4720:Errfi1 UTSW 4 150866747 missense probably damaging 1.00
R6916:Errfi1 UTSW 4 150867473 nonsense probably null
R7099:Errfi1 UTSW 4 150866768 missense probably benign 0.01
R7447:Errfi1 UTSW 4 150866651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTGCAGAGAGCTGGAAG -3'
(R):5'- AAGCTCTACCTCACTGTCGG -3'

Sequencing Primer
(F):5'- TCTCCCAGGGTGAAGGAC -3'
(R):5'- TGTCGGCCTCATCCACACATAG -3'
Posted On2020-01-23