Incidental Mutation 'R8042:Nadk'
ID618566
Institutional Source Beutler Lab
Gene Symbol Nadk
Ensembl Gene ENSMUSG00000029063
Gene NameNAD kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location155562378-155591001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155577067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 17 (D17Y)
Ref Sequence ENSEMBL: ENSMUSP00000030939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030939] [ENSMUST00000105613] [ENSMUST00000135429] [ENSMUST00000143840] [ENSMUST00000146080]
Predicted Effect probably benign
Transcript: ENSMUST00000030939
AA Change: D17Y

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030939
Gene: ENSMUSG00000029063
AA Change: D17Y

DomainStartEndE-ValueType
Pfam:NAD_kinase 106 406 2.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105613
AA Change: D17Y

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101238
Gene: ENSMUSG00000029063
AA Change: D17Y

DomainStartEndE-ValueType
Pfam:NAD_kinase 106 406 1.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135429
AA Change: D17Y

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000143840
AA Change: D17Y

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000146080
AA Change: D17Y

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117504
Gene: ENSMUSG00000029063
AA Change: D17Y

DomainStartEndE-ValueType
PDB:3PFN|D 68 85 8e-7 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions (Lerner et al., 2001 [PubMed 11594753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Nadk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Nadk APN 4 155588700 splice site probably benign
IGL02078:Nadk APN 4 155579403 unclassified probably benign
IGL02116:Nadk APN 4 155579306 splice site probably benign
IGL02951:Nadk APN 4 155587476 missense probably benign 0.00
IGL03059:Nadk APN 4 155586796 missense probably benign 0.02
IGL03203:Nadk APN 4 155585251 missense probably damaging 0.99
R0416:Nadk UTSW 4 155587799 splice site probably benign
R1633:Nadk UTSW 4 155577185 missense probably damaging 1.00
R2044:Nadk UTSW 4 155585441 missense probably damaging 1.00
R2891:Nadk UTSW 4 155587360 missense possibly damaging 0.46
R2892:Nadk UTSW 4 155587360 missense possibly damaging 0.46
R2894:Nadk UTSW 4 155587360 missense possibly damaging 0.46
R4275:Nadk UTSW 4 155584255 missense probably benign 0.44
R4386:Nadk UTSW 4 155582575 unclassified probably benign
R4416:Nadk UTSW 4 155587726 nonsense probably null
R4703:Nadk UTSW 4 155585227 missense probably benign 0.00
R4704:Nadk UTSW 4 155585227 missense probably benign 0.00
R4705:Nadk UTSW 4 155585227 missense probably benign 0.00
R5219:Nadk UTSW 4 155584254 missense probably benign 0.00
R5610:Nadk UTSW 4 155584171 missense probably damaging 1.00
R5673:Nadk UTSW 4 155585185 missense possibly damaging 0.48
R6393:Nadk UTSW 4 155589351 missense possibly damaging 0.60
R7091:Nadk UTSW 4 155587758 missense probably benign 0.00
R7144:Nadk UTSW 4 155589336 missense probably damaging 0.99
R7811:Nadk UTSW 4 155576875 intron probably benign
R7951:Nadk UTSW 4 155577067 missense probably benign 0.06
R7952:Nadk UTSW 4 155577067 missense probably benign 0.06
R8002:Nadk UTSW 4 155577198 critical splice donor site probably null
R8039:Nadk UTSW 4 155577067 missense probably benign 0.06
R8041:Nadk UTSW 4 155577067 missense probably benign 0.06
R8066:Nadk UTSW 4 155577067 missense probably benign 0.06
R8113:Nadk UTSW 4 155570670 splice site probably null
Z1177:Nadk UTSW 4 155587700 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGGGATCTTGTGGAAGG -3'
(R):5'- CTGATATCGGCTGTGTCCTCTG -3'

Sequencing Primer
(F):5'- ACAGGGATCTTGTGGAAGGTCTTG -3'
(R):5'- TCTGTAAGGATCCTAACACAGCATG -3'
Posted On2020-01-23