Incidental Mutation 'R8042:Gbp9'
ID618567
Institutional Source Beutler Lab
Gene Symbol Gbp9
Ensembl Gene ENSMUSG00000029298
Gene Nameguanylate-binding protein 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105077630-105139539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105094242 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 150 (I150F)
Ref Sequence ENSEMBL: ENSMUSP00000031238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000031238] [ENSMUST00000100961]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031238
AA Change: I150F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031238
Gene: ENSMUSG00000029298
AA Change: I150F

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.2e-117 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100961
AA Change: I150F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298
AA Change: I150F

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Gbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gbp9 APN 5 105081264 missense probably benign 0.01
IGL00419:Gbp9 APN 5 105094077 missense probably benign 0.05
IGL00425:Gbp9 APN 5 105105754 missense possibly damaging 0.82
IGL00597:Gbp9 APN 5 105094498 missense probably damaging 1.00
IGL01362:Gbp9 APN 5 105080206 missense probably damaging 1.00
IGL01679:Gbp9 APN 5 105085172 splice site probably null
IGL01803:Gbp9 APN 5 105094173 missense probably damaging 1.00
IGL01803:Gbp9 APN 5 105085018 missense probably damaging 0.99
IGL02054:Gbp9 APN 5 105082807 missense probably benign 0.12
IGL02474:Gbp9 APN 5 105094567 splice site probably benign
IGL02633:Gbp9 APN 5 105083565 splice site probably benign
IGL02666:Gbp9 APN 5 105094275 splice site probably null
IGL02689:Gbp9 APN 5 105105796 missense probably benign 0.11
IGL02812:Gbp9 APN 5 105083758 missense probably damaging 1.00
IGL03132:Gbp9 APN 5 105084953 missense possibly damaging 0.83
IGL03274:Gbp9 APN 5 105082786 missense possibly damaging 0.58
R0410:Gbp9 UTSW 5 105085073 missense probably benign 0.17
R1018:Gbp9 UTSW 5 105080260 missense probably benign 0.15
R1479:Gbp9 UTSW 5 105094064 splice site probably benign
R1655:Gbp9 UTSW 5 105081692 missense possibly damaging 0.76
R1658:Gbp9 UTSW 5 105094468 missense probably damaging 0.98
R1757:Gbp9 UTSW 5 105094453 missense probably damaging 1.00
R1950:Gbp9 UTSW 5 105081246 missense probably benign 0.01
R1986:Gbp9 UTSW 5 105105724 missense probably damaging 1.00
R1986:Gbp9 UTSW 5 105105786 missense probably damaging 0.98
R2124:Gbp9 UTSW 5 105094543 missense probably damaging 1.00
R2302:Gbp9 UTSW 5 105094092 missense possibly damaging 0.47
R2378:Gbp9 UTSW 5 105080176 missense probably benign 0.02
R2997:Gbp9 UTSW 5 105082769 missense probably benign 0.00
R3745:Gbp9 UTSW 5 105105858 start gained probably benign
R4182:Gbp9 UTSW 5 105083595 missense probably benign 0.08
R4485:Gbp9 UTSW 5 105083808 missense probably damaging 0.97
R4718:Gbp9 UTSW 5 105083758 missense probably damaging 1.00
R5063:Gbp9 UTSW 5 105085162 missense probably benign
R5099:Gbp9 UTSW 5 105094513 missense probably damaging 1.00
R5104:Gbp9 UTSW 5 105080141 missense probably benign 0.00
R5199:Gbp9 UTSW 5 105083812 missense probably benign 0.04
R5712:Gbp9 UTSW 5 105094555 missense possibly damaging 0.80
R5751:Gbp9 UTSW 5 105081258 missense probably benign 0.06
R5895:Gbp9 UTSW 5 105082858 missense probably damaging 1.00
R6360:Gbp9 UTSW 5 105083730 missense probably benign 0.03
R6646:Gbp9 UTSW 5 105082903 missense probably benign 0.13
R7559:Gbp9 UTSW 5 105085109 missense probably damaging 1.00
R7819:Gbp9 UTSW 5 105103879 missense possibly damaging 0.65
R8288:Gbp9 UTSW 5 105105733 missense probably damaging 1.00
R8303:Gbp9 UTSW 5 105081305 missense possibly damaging 0.94
R8395:Gbp9 UTSW 5 105080203 missense probably damaging 1.00
R8397:Gbp9 UTSW 5 105083598 missense possibly damaging 0.94
Z1088:Gbp9 UTSW 5 105094125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGCTTTCCAACCCTAG -3'
(R):5'- TGCTCTGGAATGAATATGCAGTC -3'

Sequencing Primer
(F):5'- CCTCCTGTACCTGGGATCAG -3'
(R):5'- AGTCACTGCCCTGCCCTG -3'
Posted On2020-01-23