Incidental Mutation 'R8042:Serpine1'
ID618568
Institutional Source Beutler Lab
Gene Symbol Serpine1
Ensembl Gene ENSMUSG00000037411
Gene Nameserine (or cysteine) peptidase inhibitor, clade E, member 1
SynonymsPAI-1, PAI1, Planh1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137061504-137072268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137067001 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 242 (L242H)
Ref Sequence ENSEMBL: ENSMUSP00000039586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041388] [ENSMUST00000077523]
Predicted Effect probably benign
Transcript: ENSMUST00000041388
AA Change: L242H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039586
Gene: ENSMUSG00000037411
AA Change: L242H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077523
AA Change: L242H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076728
Gene: ENSMUSG00000037411
AA Change: L242H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Although mice homozygous for disruptions in this gene display an essentially normal phenotype, a mild blood clotting defect does exist. Mice homozygous for an allele with amino acid substitutions exhibit decreased sensitivity to LPS-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Serpine1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Serpine1 APN 5 137063522 missense probably benign 0.01
IGL01337:Serpine1 APN 5 137069331 missense probably damaging 0.99
IGL01484:Serpine1 APN 5 137063472 splice site probably benign
IGL02134:Serpine1 APN 5 137067035 splice site probably benign
R0508:Serpine1 UTSW 5 137064916 missense probably benign 0.00
R1969:Serpine1 UTSW 5 137067747 nonsense probably null
R4515:Serpine1 UTSW 5 137069468 missense probably damaging 0.99
R4951:Serpine1 UTSW 5 137069351 missense probably benign 0.04
R5540:Serpine1 UTSW 5 137063209 missense probably benign 0.03
R7122:Serpine1 UTSW 5 137066942 missense probably benign 0.28
R7144:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7146:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7844:Serpine1 UTSW 5 137071189 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTACTTAGGCAGGATGAGG -3'
(R):5'- TGAGTTCAAGGTCACCTTCAGTG -3'

Sequencing Primer
(F):5'- CTTAGGCAGGATGAGGAGGCG -3'
(R):5'- GGAGAGGAAGACATTTGAATGGGATG -3'
Posted On2020-01-23