Incidental Mutation 'R0661:Zfp740'
ID61857
Institutional Source Beutler Lab
Gene Symbol Zfp740
Ensembl Gene ENSMUSG00000046897
Gene Namezinc finger protein 740
Synonyms
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0661 (G1)
Quality Score126
Status Not validated
Chromosome15
Chromosomal Location102203249-102215606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102212659 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000155827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001327] [ENSMUST00000118729] [ENSMUST00000119168] [ENSMUST00000119800] [ENSMUST00000121206] [ENSMUST00000133986] [ENSMUST00000139960] [ENSMUST00000141465] [ENSMUST00000229886] [ENSMUST00000230867]
Predicted Effect probably benign
Transcript: ENSMUST00000001327
SMART Domains Protein: ENSMUSP00000001327
Gene: ENSMUSG00000001281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 44 92 6.35e-6 SMART
INB 50 476 2.82e-273 SMART
VWA 151 383 7.52e-2 SMART
low complexity region 537 557 N/A INTRINSIC
Pfam:EGF_2 605 635 2.6e-7 PFAM
Integrin_B_tail 645 721 4.22e-18 SMART
low complexity region 732 744 N/A INTRINSIC
Integrin_b_cyt 746 792 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118729
AA Change: T161A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112985
Gene: ENSMUSG00000046897
AA Change: T161A

DomainStartEndE-ValueType
low complexity region 53 62 N/A INTRINSIC
ZnF_C2H2 76 98 3.07e-1 SMART
ZnF_C2H2 104 126 1.69e-3 SMART
ZnF_C2H2 132 152 4.99e1 SMART
Predicted Effect silent
Transcript: ENSMUST00000119168
Predicted Effect probably benign
Transcript: ENSMUST00000119800
AA Change: T173A

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113770
Gene: ENSMUSG00000046897
AA Change: T173A

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
ZnF_C2H2 88 110 3.07e-1 SMART
ZnF_C2H2 116 138 1.69e-3 SMART
ZnF_C2H2 144 164 4.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119830
SMART Domains Protein: ENSMUSP00000113281
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
ZnF_C2H2 25 47 3.07e-1 SMART
ZnF_C2H2 53 75 1.69e-3 SMART
ZnF_C2H2 81 101 4.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123528
Predicted Effect probably benign
Transcript: ENSMUST00000133986
SMART Domains Protein: ENSMUSP00000122429
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139960
SMART Domains Protein: ENSMUSP00000117024
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
Blast:ZnF_C2H2 88 107 9e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141465
Predicted Effect probably benign
Transcript: ENSMUST00000229440
Predicted Effect probably benign
Transcript: ENSMUST00000229886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230550
Predicted Effect possibly damaging
Transcript: ENSMUST00000230867
AA Change: T136A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Other mutations in Zfp740
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Zfp740 APN 15 102212674 missense possibly damaging 0.66
R0432:Zfp740 UTSW 15 102212659 missense possibly damaging 0.66
R0659:Zfp740 UTSW 15 102212659 missense possibly damaging 0.66
R1666:Zfp740 UTSW 15 102208318 missense probably damaging 1.00
R1830:Zfp740 UTSW 15 102207901 missense probably damaging 1.00
R3983:Zfp740 UTSW 15 102208243 missense probably benign 0.06
R4686:Zfp740 UTSW 15 102208749 unclassified probably benign
R4991:Zfp740 UTSW 15 102208279 unclassified probably null
R5170:Zfp740 UTSW 15 102209205 missense probably damaging 1.00
R5213:Zfp740 UTSW 15 102212647 missense possibly damaging 0.68
R5782:Zfp740 UTSW 15 102208366 unclassified probably benign
R6088:Zfp740 UTSW 15 102208808 missense probably damaging 1.00
R6848:Zfp740 UTSW 15 102208808 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACACAGTGTATGTCCCCTCTGAGAC -3'
(R):5'- TTTAGCTGCCAGTTCCAGTCCAAG -3'

Sequencing Primer
(F):5'- TATGTCCCCTCTGAGACAGGAAC -3'
(R):5'- TGGGATACTCATAGCCTCAGACTG -3'
Posted On2013-07-30