Incidental Mutation 'R8042:Slc6a6'
ID618570
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Namesolute carrier family 6 (neurotransmitter transporter, taurine), member 6
SynonymsTaut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91684053-91759066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 91741245 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 347 (I347L)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: I347L

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: I347L

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
durango UTSW 6 91723471 missense probably damaging 1.00
habit UTSW 6 91740971 missense probably damaging 1.00
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91741048 missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6262:Slc6a6 UTSW 6 91755032 missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91754915 missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91726039 missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91724851 missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91739965 missense probably damaging 0.99
R8125:Slc6a6 UTSW 6 91726106 missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91740971 missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91724970 missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91726243 nonsense probably null
R8363:Slc6a6 UTSW 6 91750296 missense probably benign 0.03
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGTACAGGCAAGTGTCG -3'
(R):5'- TATGGGAGCACATCTTGGGG -3'

Sequencing Primer
(F):5'- AGGCAAGTGTCGCGCTG -3'
(R):5'- GAGGGGATGTCTATGTAAAAGCC -3'
Posted On2020-01-23