Incidental Mutation 'R8042:Tmem147'
ID618572
Institutional Source Beutler Lab
Gene Symbol Tmem147
Ensembl Gene ENSMUSG00000006315
Gene Nametransmembrane protein 147
Synonyms5033425B17Rik, 2010004E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30727701-30729540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30728553 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 75 (S75C)
Ref Sequence ENSEMBL: ENSMUSP00000006478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000006478] [ENSMUST00000074758] [ENSMUST00000170371] [ENSMUST00000182067] [ENSMUST00000182634] [ENSMUST00000207263] [ENSMUST00000207296] [ENSMUST00000207779] [ENSMUST00000208169] [ENSMUST00000209065]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000006478
AA Change: S75C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006478
Gene: ENSMUSG00000006315
AA Change: S75C

DomainStartEndE-ValueType
Pfam:DUF2053 2 158 3.1e-69 PFAM
transmembrane domain 168 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074758
SMART Domains Protein: ENSMUSP00000074317
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Gp_dh_N 106 254 6.13e-79 SMART
Pfam:Gp_dh_C 259 416 2.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170371
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182067
SMART Domains Protein: ENSMUSP00000138697
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
PDB:2VYV|D 1 44 3e-15 PDB
Blast:Gp_dh_N 4 33 9e-7 BLAST
SCOP:d1cf2o2 9 45 3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182634
SMART Domains Protein: ENSMUSP00000138634
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
Gp_dh_N 108 256 6.13e-79 SMART
Pfam:Gp_dh_C 261 418 4.4e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207263
Predicted Effect probably damaging
Transcript: ENSMUST00000207296
AA Change: S75C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207779
AA Change: S75C

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000208169
Predicted Effect probably damaging
Transcript: ENSMUST00000209065
AA Change: S26C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Tmem147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tmem147 APN 7 30728433 nonsense probably null
IGL02491:Tmem147 APN 7 30728201 splice site probably benign
IGL02971:Tmem147 APN 7 30729422 unclassified probably benign
R0070:Tmem147 UTSW 7 30728101 missense probably damaging 1.00
R0609:Tmem147 UTSW 7 30728102 missense probably benign 0.03
R1167:Tmem147 UTSW 7 30727796 missense probably benign 0.33
R1254:Tmem147 UTSW 7 30729370 nonsense probably null
R5983:Tmem147 UTSW 7 30728059 missense probably damaging 1.00
R6072:Tmem147 UTSW 7 30728020 missense possibly damaging 0.56
R7636:Tmem147 UTSW 7 30728301 splice site probably null
R7705:Tmem147 UTSW 7 30728291 critical splice acceptor site probably null
R8132:Tmem147 UTSW 7 30728447 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTCTAGTACCCAGACTCC -3'
(R):5'- CTCAGATGTTGTTCTTGGCCAC -3'

Sequencing Primer
(F):5'- GCACCCAGCCTCTGATCAC -3'
(R):5'- AGATGTTGTTCTTGGCCACTTTCTTC -3'
Posted On2020-01-23