Incidental Mutation 'R8042:Tnpo2'
ID618576
Institutional Source Beutler Lab
Gene Symbol Tnpo2
Ensembl Gene ENSMUSG00000031691
Gene Nametransportin 2 (importin 3, karyopherin beta 2b)
SynonymsKpnb2b, TRN2, 1110034O24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85036915-85057583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85051559 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 564 (P564S)
Ref Sequence ENSEMBL: ENSMUSP00000091051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000166592] [ENSMUST00000211601]
Predicted Effect probably damaging
Transcript: ENSMUST00000093360
AA Change: P564S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691
AA Change: P564S

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166592
AA Change: P564S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691
AA Change: P564S

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211601
AA Change: P564S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Tnpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tnpo2 APN 8 85040526 missense probably damaging 0.98
IGL01843:Tnpo2 APN 8 85050508 missense probably damaging 0.99
IGL02475:Tnpo2 APN 8 85050502 missense probably benign 0.33
IGL02536:Tnpo2 APN 8 85045067 missense probably benign
IGL02644:Tnpo2 APN 8 85044480 missense possibly damaging 0.62
IGL02721:Tnpo2 APN 8 85054690 critical splice acceptor site probably null
IGL03155:Tnpo2 APN 8 85045080 missense probably benign 0.03
IGL03198:Tnpo2 APN 8 85051718 missense possibly damaging 0.75
R0127:Tnpo2 UTSW 8 85040628 missense probably damaging 1.00
R0456:Tnpo2 UTSW 8 85054416 missense probably damaging 1.00
R0505:Tnpo2 UTSW 8 85047362 missense probably benign 0.01
R0513:Tnpo2 UTSW 8 85053529 missense probably benign 0.00
R0531:Tnpo2 UTSW 8 85050157 missense probably damaging 1.00
R0595:Tnpo2 UTSW 8 85052041 nonsense probably null
R1113:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1308:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1851:Tnpo2 UTSW 8 85051772 missense probably damaging 1.00
R1965:Tnpo2 UTSW 8 85045317 critical splice donor site probably null
R2057:Tnpo2 UTSW 8 85050113 missense probably damaging 1.00
R2184:Tnpo2 UTSW 8 85053846 missense probably benign 0.35
R3801:Tnpo2 UTSW 8 85055171 splice site probably null
R3871:Tnpo2 UTSW 8 85054751 missense probably null 0.98
R4095:Tnpo2 UTSW 8 85038419 missense probably damaging 1.00
R4611:Tnpo2 UTSW 8 85053803 missense probably benign 0.38
R4925:Tnpo2 UTSW 8 85050025 missense probably damaging 1.00
R5744:Tnpo2 UTSW 8 85051894 nonsense probably null
R6107:Tnpo2 UTSW 8 85053475 missense probably damaging 1.00
R6581:Tnpo2 UTSW 8 85055404 missense probably damaging 1.00
R6586:Tnpo2 UTSW 8 85045202 missense possibly damaging 0.83
R7173:Tnpo2 UTSW 8 85055078 missense probably benign 0.05
R7196:Tnpo2 UTSW 8 85047137 missense possibly damaging 0.91
R7382:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7383:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7384:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7385:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7453:Tnpo2 UTSW 8 85055022 missense probably damaging 1.00
R7488:Tnpo2 UTSW 8 85055034 missense probably benign 0.03
R7638:Tnpo2 UTSW 8 85044415 missense probably benign 0.01
R8004:Tnpo2 UTSW 8 85044699 missense probably benign 0.26
R8021:Tnpo2 UTSW 8 85055206 missense probably damaging 1.00
R8403:Tnpo2 UTSW 8 85047297 missense probably benign 0.02
X0027:Tnpo2 UTSW 8 85044895 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGTTATTAGGTAGCATGGCCG -3'
(R):5'- GTAACACAGCGCTGGTAGAC -3'

Sequencing Primer
(F):5'- TAGCATGGCCGCTGCTG -3'
(R):5'- CTGGTAGACAGGCTCGCAGTAG -3'
Posted On2020-01-23