Incidental Mutation 'R8042:Pml'
ID618577
Institutional Source Beutler Lab
Gene Symbol Pml
Ensembl Gene ENSMUSG00000036986
Gene Namepromyelocytic leukemia
SynonymsTrim19, 1200009E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58218076-58249786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58234685 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 288 (R288L)
Ref Sequence ENSEMBL: ENSMUSP00000082816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085673] [ENSMUST00000114136] [ENSMUST00000124063] [ENSMUST00000135310] [ENSMUST00000148301] [ENSMUST00000153820]
Predicted Effect probably benign
Transcript: ENSMUST00000085673
AA Change: R288L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082816
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 5e-7 BLAST
Pfam:DUF3583 244 580 4e-166 PFAM
Blast:EXOIII 619 762 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114136
AA Change: R288L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109771
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 434 5.5e-109 PFAM
Pfam:DUF3583 428 535 1.4e-57 PFAM
Blast:EXOIII 573 716 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124063
SMART Domains Protein: ENSMUSP00000118232
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116787
Gene: ENSMUSG00000036986
AA Change: R279L

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
RING 54 88 1.83e-3 SMART
BBOX 121 163 4.99e-5 SMART
Blast:BBOX 181 225 4e-7 BLAST
Pfam:DUF3583 236 422 1.4e-89 PFAM
Pfam:DUF3583 411 526 2.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135310
AA Change: R288L

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122854
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 8.8e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148301
SMART Domains Protein: ENSMUSP00000120620
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153820
AA Change: R288L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118955
Gene: ENSMUSG00000036986
AA Change: R288L

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 9.2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene have an increased susceptibility to infection and to induction of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Pml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Pml APN 9 58247003 missense probably benign 0.04
IGL03147:Pml UTSW 9 58230043 missense possibly damaging 0.85
R0019:Pml UTSW 9 58220493 missense probably damaging 1.00
R0905:Pml UTSW 9 58249539 critical splice donor site probably null
R1171:Pml UTSW 9 58234538 missense probably damaging 1.00
R2189:Pml UTSW 9 58234874 missense probably benign 0.00
R2330:Pml UTSW 9 58234571 missense probably damaging 1.00
R2909:Pml UTSW 9 58247243 missense possibly damaging 0.75
R4749:Pml UTSW 9 58234652 missense probably damaging 0.99
R5228:Pml UTSW 9 58219997 missense probably damaging 1.00
R5300:Pml UTSW 9 58247019 missense probably damaging 1.00
R5669:Pml UTSW 9 58247063 missense probably benign 0.00
R5876:Pml UTSW 9 58233182 missense possibly damaging 0.71
R6854:Pml UTSW 9 58219906 missense probably damaging 0.99
R6996:Pml UTSW 9 58234886 missense probably damaging 1.00
R7387:Pml UTSW 9 58229894 missense probably benign 0.08
R7448:Pml UTSW 9 58247213 missense probably benign 0.27
R7762:Pml UTSW 9 58220173 missense probably damaging 1.00
R7833:Pml UTSW 9 58234685 missense probably benign 0.15
R7834:Pml UTSW 9 58234685 missense probably benign 0.15
R7903:Pml UTSW 9 58249584 missense probably benign 0.01
R8040:Pml UTSW 9 58234685 missense probably benign 0.15
R8041:Pml UTSW 9 58234685 missense probably benign 0.15
R8046:Pml UTSW 9 58246973 critical splice donor site probably null
R8284:Pml UTSW 9 58229360 missense probably benign 0.15
Z1088:Pml UTSW 9 58234590 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCTACAGAGTGCCTTGCG -3'
(R):5'- ATCTCCATTGCGATATTGGTGAGG -3'

Sequencing Primer
(F):5'- CGCAGAAAGCTGTGCATATC -3'
(R):5'- CGATATTGGTGAGGAGATTCAGC -3'
Posted On2020-01-23