Incidental Mutation 'R8042:Azi2'
ID618578
Institutional Source Beutler Lab
Gene Symbol Azi2
Ensembl Gene ENSMUSG00000039285
Gene Name5-azacytidine induced gene 2
SynonymsAZ2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location118040499-118069794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118062097 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 397 (Q397K)
Ref Sequence ENSEMBL: ENSMUSP00000044350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044220] [ENSMUST00000044454] [ENSMUST00000133580] [ENSMUST00000134433] [ENSMUST00000135251] [ENSMUST00000154583] [ENSMUST00000215799]
Predicted Effect probably benign
Transcript: ENSMUST00000044220
SMART Domains Protein: ENSMUSP00000047904
Gene: ENSMUSG00000039163

DomainStartEndE-ValueType
Pfam:Cmc1 19 87 5.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044454
AA Change: Q397K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000044350
Gene: ENSMUSG00000039285
AA Change: Q397K

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 278 4.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123690
SMART Domains Protein: ENSMUSP00000121245
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
Pfam:TBD 1 51 4.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130735
SMART Domains Protein: ENSMUSP00000114634
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 22 123 N/A INTRINSIC
Pfam:TBD 153 197 3.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133580
AA Change: Q397K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118765
Gene: ENSMUSG00000039285
AA Change: Q397K

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 226 278 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134433
SMART Domains Protein: ENSMUSP00000114980
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 273 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135251
SMART Domains Protein: ENSMUSP00000116971
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 20 50 N/A INTRINSIC
Pfam:TBD 77 131 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154583
SMART Domains Protein: ENSMUSP00000122063
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215799
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired GM-CSF-derived bone marrow-derived dendritic cell differenatiation, cytokine response and ability to stimulate T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Azi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Azi2 APN 9 118059146 missense probably damaging 0.97
awry UTSW 9 118047419 start codon destroyed probably null 0.99
R0166:Azi2 UTSW 9 118055841 missense possibly damaging 0.82
R0636:Azi2 UTSW 9 118062057 missense probably benign 0.03
R2024:Azi2 UTSW 9 118049322 nonsense probably null
R3498:Azi2 UTSW 9 118049407 missense probably damaging 0.99
R3713:Azi2 UTSW 9 118047440 missense possibly damaging 0.65
R3899:Azi2 UTSW 9 118047503 missense probably damaging 1.00
R4765:Azi2 UTSW 9 118061471 unclassified probably benign
R5227:Azi2 UTSW 9 118047458 missense probably damaging 1.00
R5839:Azi2 UTSW 9 118059119 missense probably damaging 1.00
R5885:Azi2 UTSW 9 118047560 missense probably damaging 1.00
R6021:Azi2 UTSW 9 118047419 start codon destroyed probably null 0.99
R6276:Azi2 UTSW 9 118049338 missense probably damaging 0.96
R6408:Azi2 UTSW 9 118061482 nonsense probably null
R6525:Azi2 UTSW 9 118047595 missense probably damaging 0.96
R6889:Azi2 UTSW 9 118049895 critical splice acceptor site probably null
R7391:Azi2 UTSW 9 118050892 splice site probably null
R7693:Azi2 UTSW 9 118047593 missense probably damaging 1.00
R7889:Azi2 UTSW 9 118061915 missense probably benign 0.20
R8142:Azi2 UTSW 9 118049407 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAGATAACGAGAGATTGGTTCC -3'
(R):5'- AAAGGTACAACTGGAGGTTCCC -3'

Sequencing Primer
(F):5'- TTCCTAATGACGGTGCAGAC -3'
(R):5'- GTACAACTGGAGGTTCCCATACTG -3'
Posted On2020-01-23