Incidental Mutation 'R8042:Nt5dc1'
ID618579
Institutional Source Beutler Lab
Gene Symbol Nt5dc1
Ensembl Gene ENSMUSG00000039480
Gene Name5'-nucleotidase domain containing 1
SynonymsNt5c2l1, 6030401B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location34288288-34418552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34397214 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 196 (D196G)
Ref Sequence ENSEMBL: ENSMUSP00000097553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000099973] [ENSMUST00000105511] [ENSMUST00000105512] [ENSMUST00000213269]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099973
AA Change: D196G

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097553
Gene: ENSMUSG00000039480
AA Change: D196G

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 189 8.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105511
SMART Domains Protein: ENSMUSP00000101150
Gene: ENSMUSG00000039462

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 60 101 N/A INTRINSIC
Pfam:Collagen 103 155 1.4e-9 PFAM
Pfam:Collagen 153 218 1.4e-8 PFAM
Pfam:Collagen 193 250 2.6e-9 PFAM
Pfam:Collagen 206 264 3.8e-8 PFAM
low complexity region 282 323 N/A INTRINSIC
internal_repeat_2 329 361 2.25e-6 PROSPERO
internal_repeat_1 331 365 5.9e-14 PROSPERO
low complexity region 368 383 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
Pfam:Collagen 413 483 9.3e-10 PFAM
low complexity region 487 517 N/A INTRINSIC
C1Q 545 680 2.85e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105512
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213269
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While the exact function of the protein encoded by this gene is not known, it belongs to the 5'(3')-deoxyribonucleotidase family. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Nt5dc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Nt5dc1 APN 10 34407557 missense possibly damaging 0.80
IGL02096:Nt5dc1 APN 10 34399810 nonsense probably null
IGL02471:Nt5dc1 APN 10 34403725 missense probably benign 0.03
IGL03345:Nt5dc1 APN 10 34324462 missense probably benign 0.04
R0083:Nt5dc1 UTSW 10 34403764 missense probably damaging 0.98
R1159:Nt5dc1 UTSW 10 34398173 missense possibly damaging 0.93
R1898:Nt5dc1 UTSW 10 34313635 missense probably benign 0.00
R1901:Nt5dc1 UTSW 10 34313671 missense probably damaging 1.00
R2327:Nt5dc1 UTSW 10 34313677 missense possibly damaging 0.66
R4365:Nt5dc1 UTSW 10 34310381 missense probably benign 0.20
R4942:Nt5dc1 UTSW 10 34322677 missense probably damaging 1.00
R4943:Nt5dc1 UTSW 10 34310391 missense probably damaging 1.00
R5168:Nt5dc1 UTSW 10 34397240 missense probably benign 0.05
R5507:Nt5dc1 UTSW 10 34397230 missense probably benign
R5605:Nt5dc1 UTSW 10 34403695 missense probably benign 0.12
R6406:Nt5dc1 UTSW 10 34324408 missense probably benign 0.04
R6495:Nt5dc1 UTSW 10 34324369 missense probably damaging 1.00
R6799:Nt5dc1 UTSW 10 34313707 missense possibly damaging 0.79
R6835:Nt5dc1 UTSW 10 34310379 missense probably benign 0.04
R7480:Nt5dc1 UTSW 10 34324453 missense probably damaging 1.00
R7480:Nt5dc1 UTSW 10 34324454 missense probably damaging 1.00
R7486:Nt5dc1 UTSW 10 34399809 missense probably benign 0.26
R7493:Nt5dc1 UTSW 10 34304936 missense probably benign 0.00
R7638:Nt5dc1 UTSW 10 34314796 missense probably benign 0.04
R8160:Nt5dc1 UTSW 10 34324396 missense possibly damaging 0.79
R8268:Nt5dc1 UTSW 10 34310411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCGGAGTATTTAATCTACTTGG -3'
(R):5'- CTCCTTTTCAGTAAATCAAGCCACC -3'

Sequencing Primer
(F):5'- TTTACAGCTTCGCACTGG -3'
(R):5'- ATTGCAGGATATTGGTTCCAATTTG -3'
Posted On2020-01-23