Incidental Mutation 'R0661:Anks3'
ID61858
Institutional Source Beutler Lab
Gene Symbol Anks3
Ensembl Gene ENSMUSG00000022515
Gene Nameankyrin repeat and sterile alpha motif domain containing 3
Synonyms2700067D09Rik
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0661 (G1)
Quality Score100
Status Not validated
Chromosome16
Chromosomal Location4941436-4964205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4948334 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 124 (F124L)
Ref Sequence ENSEMBL: ENSMUSP00000155720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023157] [ENSMUST00000229017] [ENSMUST00000229765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023157
AA Change: F299L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023157
Gene: ENSMUSG00000022515
AA Change: F299L

DomainStartEndE-ValueType
ANK 34 64 1.25e2 SMART
ANK 68 97 9.93e-5 SMART
ANK 101 130 9.13e-4 SMART
ANK 134 163 2.45e-4 SMART
ANK 168 197 9.27e-5 SMART
ANK 201 230 5.87e2 SMART
SAM 421 487 9.8e-12 SMART
coiled coil region 500 533 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229017
AA Change: F124L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000229272
AA Change: F3L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229477
Predicted Effect probably damaging
Transcript: ENSMUST00000229765
AA Change: F299L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230493
Predicted Effect probably benign
Transcript: ENSMUST00000231036
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Anks3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Anks3 APN 16 4953929 missense possibly damaging 0.93
IGL01705:Anks3 APN 16 4947723 missense probably benign 0.00
IGL01953:Anks3 APN 16 4960544 missense probably damaging 1.00
IGL02378:Anks3 APN 16 4950762 missense possibly damaging 0.91
IGL03126:Anks3 APN 16 4958027 missense probably damaging 1.00
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0855:Anks3 UTSW 16 4955947 splice site probably benign
R0932:Anks3 UTSW 16 4953827 missense probably damaging 1.00
R1604:Anks3 UTSW 16 4948253 missense probably damaging 0.99
R1773:Anks3 UTSW 16 4947294 missense probably benign
R1846:Anks3 UTSW 16 4953884 missense probably benign 0.07
R1928:Anks3 UTSW 16 4946054 critical splice donor site probably null
R2323:Anks3 UTSW 16 4950770 critical splice acceptor site probably null
R3916:Anks3 UTSW 16 4947279 missense probably damaging 0.97
R5597:Anks3 UTSW 16 4953929 missense possibly damaging 0.93
R5993:Anks3 UTSW 16 4958137 missense probably damaging 1.00
R7345:Anks3 UTSW 16 4955910 missense possibly damaging 0.88
R7373:Anks3 UTSW 16 4955871 missense probably benign 0.00
Z1176:Anks3 UTSW 16 4950714 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTGAGTACTGTGTGCCTCATCAACC -3'
(R):5'- CGCTCATGTCCCGTGATGTACAAG -3'

Sequencing Primer
(F):5'- TCCAGAATCGGGATGCTTGC -3'
(R):5'- GATGTACAAGCTCATCTCTCTTGG -3'
Posted On2013-07-30