Incidental Mutation 'R8042:Cep85l'
ID618580
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Namecentrosomal protein 85-like
SynonymsGm9766
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location53273443-53379947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53348663 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 277 (Y277H)
Ref Sequence ENSEMBL: ENSMUSP00000151909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046221] [ENSMUST00000095691] [ENSMUST00000163319] [ENSMUST00000218468] [ENSMUST00000219491] [ENSMUST00000219921] [ENSMUST00000220197] [ENSMUST00000220376] [ENSMUST00000220443]
Predicted Effect probably benign
Transcript: ENSMUST00000046221
SMART Domains Protein: ENSMUSP00000045709
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: Y175H

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163319
SMART Domains Protein: ENSMUSP00000132743
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218468
Predicted Effect probably benign
Transcript: ENSMUST00000219491
Predicted Effect probably benign
Transcript: ENSMUST00000219921
Predicted Effect probably benign
Transcript: ENSMUST00000220197
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000220443
AA Change: Y277H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53348501 missense probably benign 0.00
R0689:Cep85l UTSW 10 53348847 missense probably damaging 1.00
R0750:Cep85l UTSW 10 53281546 missense probably damaging 0.99
R0969:Cep85l UTSW 10 53281496 missense probably benign 0.00
R1375:Cep85l UTSW 10 53349258 missense probably damaging 0.99
R1542:Cep85l UTSW 10 53301584 missense probably damaging 1.00
R1611:Cep85l UTSW 10 53348681 missense probably benign
R1749:Cep85l UTSW 10 53278154 missense probably damaging 1.00
R1826:Cep85l UTSW 10 53348812 missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53278075 utr 3 prime probably benign
R2043:Cep85l UTSW 10 53358128 missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53358126 missense probably benign 0.04
R2186:Cep85l UTSW 10 53348618 missense probably damaging 0.97
R2201:Cep85l UTSW 10 53348731 missense probably benign 0.01
R3767:Cep85l UTSW 10 53291810 missense probably benign 0.09
R5249:Cep85l UTSW 10 53319594 splice site probably null
R5764:Cep85l UTSW 10 53348994 missense probably benign 0.00
R6207:Cep85l UTSW 10 53281555 missense probably benign
R6333:Cep85l UTSW 10 53349101 nonsense probably null
R6422:Cep85l UTSW 10 53291780 missense possibly damaging 0.62
R6511:Cep85l UTSW 10 53278092 missense probably benign 0.00
R6645:Cep85l UTSW 10 53301672 missense probably benign 0.26
R6863:Cep85l UTSW 10 53349118 missense probably damaging 1.00
R6904:Cep85l UTSW 10 53349098 missense probably benign 0.00
R7000:Cep85l UTSW 10 53298199 missense probably damaging 1.00
R7015:Cep85l UTSW 10 53349055 missense possibly damaging 0.89
R7256:Cep85l UTSW 10 53296255 missense probably damaging 1.00
R7425:Cep85l UTSW 10 53301570 missense probably damaging 1.00
R7583:Cep85l UTSW 10 53281354 missense probably damaging 1.00
R7796:Cep85l UTSW 10 53281401 missense probably damaging 0.96
R7960:Cep85l UTSW 10 53296307 missense probably benign
R7969:Cep85l UTSW 10 53298184 missense probably damaging 1.00
R8103:Cep85l UTSW 10 53299324 splice site probably null
R8251:Cep85l UTSW 10 53281354 missense probably damaging 1.00
R8460:Cep85l UTSW 10 53349217 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCCACTGGAGGGAAGCAAAC -3'
(R):5'- AAAGCGGTCATCAACTCTGGAC -3'

Sequencing Primer
(F):5'- AGCCTTACCTGCATTGGCG -3'
(R):5'- GACATACAGTGCCTTACCT -3'
Posted On2020-01-23