Incidental Mutation 'R8042:Mgat4b'
ID618581
Institutional Source Beutler Lab
Gene Symbol Mgat4b
Ensembl Gene ENSMUSG00000036620
Gene Namemannoside acetylglucosaminyltransferase 4, isoenzyme B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50210890-50235103 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 50232376 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 263 (Y263*)
Ref Sequence ENSEMBL: ENSMUSP00000043346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041725] [ENSMUST00000101265] [ENSMUST00000102772] [ENSMUST00000125555] [ENSMUST00000147468] [ENSMUST00000221525]
Predicted Effect probably null
Transcript: ENSMUST00000041725
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000043346
Gene: ENSMUSG00000036620
AA Change: Y263*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_transf_54 98 387 6.6e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101265
SMART Domains Protein: ENSMUSP00000098823
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
Pfam:MAPEG 8 112 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102772
SMART Domains Protein: ENSMUSP00000099833
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
Pfam:MAPEG 8 131 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125555
SMART Domains Protein: ENSMUSP00000121584
Gene: ENSMUSG00000020377

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147468
Predicted Effect probably null
Transcript: ENSMUST00000151803
AA Change: Y210*
SMART Domains Protein: ENSMUSP00000116802
Gene: ENSMUSG00000036620
AA Change: Y210*

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 46 252 1.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221525
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme A, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed targeted allele are viable and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Mgat4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01628:Mgat4b APN 11 50233309 missense probably benign 0.01
IGL01980:Mgat4b APN 11 50230713 missense probably damaging 1.00
IGL02533:Mgat4b APN 11 50233552 missense probably damaging 0.99
IGL02729:Mgat4b APN 11 50233309 missense probably benign 0.01
IGL02888:Mgat4b APN 11 50232332 missense probably damaging 1.00
IGL03369:Mgat4b APN 11 50234109 missense possibly damaging 0.79
R0085:Mgat4b UTSW 11 50230999 missense possibly damaging 0.87
R0136:Mgat4b UTSW 11 50231081 missense possibly damaging 0.91
R0394:Mgat4b UTSW 11 50230919 splice site probably null
R0631:Mgat4b UTSW 11 50230763 missense probably damaging 1.00
R0657:Mgat4b UTSW 11 50231081 missense possibly damaging 0.91
R3932:Mgat4b UTSW 11 50233338 missense possibly damaging 0.70
R4419:Mgat4b UTSW 11 50232986 missense probably damaging 0.99
R4816:Mgat4b UTSW 11 50211021 missense probably benign 0.01
R6315:Mgat4b UTSW 11 50231764 missense probably damaging 1.00
R6677:Mgat4b UTSW 11 50233071 splice site probably null
R6786:Mgat4b UTSW 11 50230698 missense probably damaging 1.00
R7053:Mgat4b UTSW 11 50233540 missense probably damaging 1.00
R7798:Mgat4b UTSW 11 50225670 missense possibly damaging 0.91
R8165:Mgat4b UTSW 11 50210974 missense probably benign 0.09
R8428:Mgat4b UTSW 11 50230685 missense not run
Predicted Primers PCR Primer
(F):5'- TCATTGTCTCCTCGGAGGTC -3'
(R):5'- ATGTCATCCTCCAGCTGCAG -3'

Sequencing Primer
(F):5'- CTCCTCGGAGGTCTGTGTG -3'
(R):5'- ATCCTCCAGCTGCAGAGAGG -3'
Posted On2020-01-23