Incidental Mutation 'R8042:Acly'
ID618586
Institutional Source Beutler Lab
Gene Symbol Acly
Ensembl Gene ENSMUSG00000020917
Gene NameATP citrate lyase
SynonymsA730098H14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001199296.1, NM_134037.3; MGI: 103251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100476353-100528000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100514325 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 339 (I339T)
Ref Sequence ENSEMBL: ENSMUSP00000103012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000107385] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect probably damaging
Transcript: ENSMUST00000007131
AA Change: I339T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917
AA Change: I339T

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107385
AA Change: I339T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103008
Gene: ENSMUSG00000020917
AA Change: I339T

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.1e-6 PFAM
SCOP:d1eucb1 255 417 1e-26 SMART
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107389
AA Change: I339T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917
AA Change: I339T

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165111
AA Change: I339T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917
AA Change: I339T

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Meta Mutation Damage Score 0.8111 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype Strain: 5287022; 3036686
Lethality: E7-E8
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic lethality. Heterozygous mutants display no obvious abnormalities. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI

All alleles(37) : Targeted(1) Gene trapped(35) Transgenic(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Acly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Acly APN 11 100495910 missense probably benign 0.00
IGL01661:Acly APN 11 100514342 splice site probably benign
IGL02349:Acly APN 11 100519679 missense probably benign 0.01
IGL02792:Acly APN 11 100478410 missense probably damaging 0.97
IGL03026:Acly APN 11 100519690 missense possibly damaging 0.94
IGL03144:Acly APN 11 100515083 missense possibly damaging 0.84
IGL03230:Acly APN 11 100494059 missense probably damaging 0.99
IGL03266:Acly APN 11 100483752 missense probably damaging 1.00
coyote UTSW 11 100479255 missense probably damaging 0.99
lupine UTSW 11 100515905 missense probably damaging 1.00
P0014:Acly UTSW 11 100484604 missense probably benign 0.03
R0195:Acly UTSW 11 100512974 missense possibly damaging 0.56
R0319:Acly UTSW 11 100504982 missense probably damaging 1.00
R0598:Acly UTSW 11 100478390 missense probably damaging 1.00
R1115:Acly UTSW 11 100479255 missense probably damaging 0.99
R1201:Acly UTSW 11 100493935 missense probably damaging 1.00
R1498:Acly UTSW 11 100483801 missense probably benign 0.27
R1593:Acly UTSW 11 100481755 missense possibly damaging 0.74
R1804:Acly UTSW 11 100515905 missense probably damaging 1.00
R1817:Acly UTSW 11 100495891 missense probably benign 0.00
R1980:Acly UTSW 11 100495876 missense possibly damaging 0.87
R1997:Acly UTSW 11 100519151 missense probably damaging 1.00
R2125:Acly UTSW 11 100523496 missense probably benign 0.01
R3001:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3002:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3003:Acly UTSW 11 100504227 missense possibly damaging 0.91
R5194:Acly UTSW 11 100523546 missense probably benign
R5509:Acly UTSW 11 100514979 missense probably damaging 0.97
R5594:Acly UTSW 11 100522120 splice site probably null
R6077:Acly UTSW 11 100519757 missense probably benign
R6310:Acly UTSW 11 100482220 missense possibly damaging 0.92
R7099:Acly UTSW 11 100492291 splice site probably null
R7148:Acly UTSW 11 100483782 missense possibly damaging 0.49
R7149:Acly UTSW 11 100484625 missense probably damaging 1.00
R7349:Acly UTSW 11 100521991 missense probably benign
R7450:Acly UTSW 11 100479275 missense probably damaging 1.00
R7484:Acly UTSW 11 100495963 missense probably damaging 1.00
R7687:Acly UTSW 11 100504854 critical splice donor site probably null
R7728:Acly UTSW 11 100516797 missense probably damaging 1.00
R7728:Acly UTSW 11 100519687 missense probably benign 0.06
R7750:Acly UTSW 11 100478013 critical splice donor site probably null
R8221:Acly UTSW 11 100519750 missense probably damaging 1.00
X0028:Acly UTSW 11 100495933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCTTCCACAAGGACCCTAGG -3'
(R):5'- ATTCTGGGAAGATCATCCTGC -3'

Sequencing Primer
(F):5'- TAGGAGTCCTAGGGTCCAATCTC -3'
(R):5'- GGAAGATCATCCTGCTCGCTC -3'
Posted On2020-01-23