Incidental Mutation 'R8042:Zfp738'
ID618592
Institutional Source Beutler Lab
Gene Symbol Zfp738
Ensembl Gene ENSMUSG00000048280
Gene Namezinc finger protein 738
Synonyms6720487G11Rik, 3830402I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67658685-67687071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67670891 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 327 (L327S)
Ref Sequence ENSEMBL: ENSMUSP00000121275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110973] [ENSMUST00000125495] [ENSMUST00000137496] [ENSMUST00000175678] [ENSMUST00000175821]
Predicted Effect probably benign
Transcript: ENSMUST00000110973
SMART Domains Protein: ENSMUSP00000106600
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 2 62 1.97e-31 SMART
SCOP:d1fgja_ 76 119 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125495
SMART Domains Protein: ENSMUSP00000135683
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137496
AA Change: L327S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121275
Gene: ENSMUSG00000048280
AA Change: L327S

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
ZnF_C2H2 91 111 3.13e1 SMART
ZnF_C2H2 119 141 9.56e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 8.34e-3 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
ZnF_C2H2 343 365 8.34e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 427 449 9.58e-3 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
ZnF_C2H2 567 589 5.42e-2 SMART
ZnF_C2H2 595 617 7.78e-3 SMART
ZnF_C2H2 623 645 2.05e-2 SMART
ZnF_C2H2 651 673 2.57e-3 SMART
ZnF_C2H2 679 701 7.26e-3 SMART
ZnF_C2H2 735 757 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175678
SMART Domains Protein: ENSMUSP00000134865
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175821
SMART Domains Protein: ENSMUSP00000135050
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
ZnF_C2H2 81 101 3.13e1 SMART
ZnF_C2H2 109 131 9.56e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 3.21e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Other mutations in Zfp738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zfp738 APN 13 67683401 critical splice donor site probably null
IGL01734:Zfp738 APN 13 67683444 utr 5 prime probably benign
IGL01980:Zfp738 APN 13 67669977 missense possibly damaging 0.80
IGL02052:Zfp738 APN 13 67671481 missense possibly damaging 0.87
IGL02330:Zfp738 APN 13 67671431 missense probably damaging 0.99
IGL02686:Zfp738 APN 13 67673652 missense probably damaging 1.00
I2505:Zfp738 UTSW 13 67673067 missense probably benign 0.36
R0219:Zfp738 UTSW 13 67683389 intron probably benign
R0491:Zfp738 UTSW 13 67670021 missense possibly damaging 0.87
R0722:Zfp738 UTSW 13 67671524 missense probably benign 0.09
R1116:Zfp738 UTSW 13 67670243 splice site probably null
R1425:Zfp738 UTSW 13 67670775 missense possibly damaging 0.77
R1854:Zfp738 UTSW 13 67670357 missense probably damaging 1.00
R2095:Zfp738 UTSW 13 67671303 missense probably damaging 1.00
R2171:Zfp738 UTSW 13 67670977 nonsense probably null
R2180:Zfp738 UTSW 13 67671194 missense probably damaging 1.00
R2225:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2226:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2907:Zfp738 UTSW 13 67670112 missense probably benign 0.33
R3605:Zfp738 UTSW 13 67671389 nonsense probably null
R4731:Zfp738 UTSW 13 67669914 missense probably damaging 1.00
R5037:Zfp738 UTSW 13 67670201 missense probably damaging 1.00
R5223:Zfp738 UTSW 13 67673063 missense probably damaging 0.99
R5259:Zfp738 UTSW 13 67669686 missense probably benign
R5358:Zfp738 UTSW 13 67671012 missense probably damaging 0.98
R6404:Zfp738 UTSW 13 67671060 missense possibly damaging 0.89
R6874:Zfp738 UTSW 13 67670263 missense possibly damaging 0.93
R7041:Zfp738 UTSW 13 67670301 missense probably damaging 1.00
R7172:Zfp738 UTSW 13 67670408 missense probably damaging 1.00
R7178:Zfp738 UTSW 13 67673028 missense probably damaging 1.00
R7308:Zfp738 UTSW 13 67669553 missense probably benign 0.00
R7386:Zfp738 UTSW 13 67670250 missense probably damaging 1.00
R7453:Zfp738 UTSW 13 67670355 missense probably benign 0.42
R7456:Zfp738 UTSW 13 67669500 missense probably damaging 1.00
R7467:Zfp738 UTSW 13 67672961 missense probably benign 0.03
R7615:Zfp738 UTSW 13 67670203 missense probably damaging 0.96
R7663:Zfp738 UTSW 13 67683401 critical splice donor site probably null
R7752:Zfp738 UTSW 13 67672991 nonsense probably null
R7901:Zfp738 UTSW 13 67672991 nonsense probably null
R8288:Zfp738 UTSW 13 67670789 missense possibly damaging 0.88
R8340:Zfp738 UTSW 13 67671112 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACAGAGAACGGAAAGCCT -3'
(R):5'- CCTTCCATAGTCCATCATTAAGTTCTG -3'

Sequencing Primer
(F):5'- CGGAAAGCCTTTTGACATACTTCAC -3'
(R):5'- CCATACAAGTGTACAGTATGTGGC -3'
Posted On2020-01-23