Incidental Mutation 'R8042:Syt12'
ID618601
Institutional Source Beutler Lab
Gene Symbol Syt12
Ensembl Gene ENSMUSG00000049303
Gene Namesynaptotagmin XII
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4445908-4477447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4453824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 260 (V260F)
Ref Sequence ENSEMBL: ENSMUSP00000055237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059295] [ENSMUST00000166191]
Predicted Effect probably damaging
Transcript: ENSMUST00000059295
AA Change: V260F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055237
Gene: ENSMUSG00000049303
AA Change: V260F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
C2 168 272 1.8e-6 SMART
C2 299 405 4.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166191
SMART Domains Protein: ENSMUSP00000130418
Gene: ENSMUSG00000049303

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown that the encoded protein selectively modulates spontaneous synaptic-vesicle exocytosis and may also be involved in regulating calcium independent secretion in nonneuronal cells. Alternative splicing results in multiple transcript variants. The gene has previously been referred to as synaptotagmin XI but has been renamed synaptotagmin XII to be standard with mouse and rat official nomenclature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Syt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt12 APN 19 4447845 missense probably damaging 0.99
IGL02045:Syt12 APN 19 4447734 missense probably damaging 1.00
IGL02942:Syt12 APN 19 4447830 missense probably benign 0.16
IGL03131:Syt12 APN 19 4456854 missense probably benign
R1308:Syt12 UTSW 19 4460735 missense probably damaging 0.99
R1830:Syt12 UTSW 19 4456883 missense probably benign
R1858:Syt12 UTSW 19 4447797 missense probably damaging 1.00
R4192:Syt12 UTSW 19 4447681 utr 3 prime probably benign
R5646:Syt12 UTSW 19 4456541 missense possibly damaging 0.54
R5769:Syt12 UTSW 19 4451044 missense probably damaging 1.00
R5785:Syt12 UTSW 19 4450994 missense possibly damaging 0.95
R6079:Syt12 UTSW 19 4456868 missense probably benign
R7017:Syt12 UTSW 19 4460867 intron probably null
R7043:Syt12 UTSW 19 4451021 missense probably benign 0.04
R7137:Syt12 UTSW 19 4453950 missense probably damaging 1.00
U15987:Syt12 UTSW 19 4456868 missense probably benign
Z1177:Syt12 UTSW 19 4453928 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCAATGAGTGGCTTCCCTAG -3'
(R):5'- GTAGAACTGAGATGGTGGTACC -3'

Sequencing Primer
(F):5'- GGGACCCTGTCTCTGTTCTAACG -3'
(R):5'- TGGTGGTACCAGGAAGCC -3'
Posted On2020-01-23