Incidental Mutation 'R8042:Vsig1'
ID618602
Institutional Source Beutler Lab
Gene Symbol Vsig1
Ensembl Gene ENSMUSG00000031430
Gene NameV-set and immunoglobulin domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R8042 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location140907608-140939472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140933126 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 232 (H232Y)
Ref Sequence ENSEMBL: ENSMUSP00000033806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033806]
Predicted Effect probably benign
Transcript: ENSMUST00000033806
AA Change: H232Y

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033806
Gene: ENSMUSG00000031430
AA Change: H232Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 29 139 3.51e-8 SMART
IGc2 154 220 5.93e-6 SMART
transmembrane domain 237 259 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the junctional adhesion molecule (JAM) family. The encoded protein contains multiple glycosylation sites at the N-terminal region, and multiple phosphorylation sites and glutamic acid/proline (EP) repeats at the C-terminal region. The gene is expressed in normal stomach and testis, as well as in gastric, esophageal and ovarian cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Male chimeras hemizygous for a knock-out allele exhibit abnormal differentiation of gastric epithelia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Ctc1 T A 11: 69,029,843 probably benign Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Vsig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vsig1 APN X 140937680 missense possibly damaging 0.90
IGL03002:Vsig1 APN X 140926339 missense probably damaging 1.00
IGL03029:Vsig1 APN X 140926512 missense possibly damaging 0.55
R0383:Vsig1 UTSW X 140936313 missense possibly damaging 0.87
R4616:Vsig1 UTSW X 140926386 missense probably benign 0.01
R4617:Vsig1 UTSW X 140926386 missense probably benign 0.01
R4618:Vsig1 UTSW X 140926386 missense probably benign 0.01
R4675:Vsig1 UTSW X 140933112 missense probably damaging 1.00
R7833:Vsig1 UTSW X 140933126 missense probably benign 0.01
R8039:Vsig1 UTSW X 140933126 missense probably benign 0.01
R8041:Vsig1 UTSW X 140933126 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTGGAGTTAAGCAATGTAAACTG -3'
(R):5'- TCCTAGACTGTTAGTAACACCACTG -3'

Sequencing Primer
(F):5'- AGTTAAGCAATGTAAACTGAGATGAC -3'
(R):5'- GCCTACTTTCTAATGATTGTGATGC -3'
Posted On2020-01-23