Incidental Mutation 'R8043:Epha5'
ID618617
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8043 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84233654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 446 (V446A)
Ref Sequence ENSEMBL: ENSMUSP00000109030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect probably benign
Transcript: ENSMUST00000053733
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113398
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113399
AA Change: V446A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: V446A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113401
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113403
AA Change: V446A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: V446A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113406
AA Change: V446A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: V446A

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Meta Mutation Damage Score 0.2247 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Atl1 T C 12: 69,959,215 Y432H probably damaging Het
Cacnb4 C T 2: 52,465,651 V215M probably damaging Het
Cep170 C T 1: 176,769,242 M516I probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Col6a6 A T 9: 105,699,020 V2047E probably damaging Het
Coro1c C T 5: 113,865,759 silent Het
Cplx4 A T 18: 65,957,119 probably null Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Esam T C 9: 37,537,021 V252A probably damaging Het
F13b T G 1: 139,522,448 M616R probably benign Het
Fbxw21 T C 9: 109,146,626 Y234C probably benign Het
Fshr C T 17: 88,986,390 E287K probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Gpr3 G A 4: 133,210,960 R134C probably damaging Het
Greb1 T C 12: 16,711,789 E530G probably damaging Het
Hmgcs2 C T 3: 98,291,128 R116C probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kcnq5 T A 1: 21,479,420 Q361L probably damaging Het
Lrrc40 T C 3: 158,063,760 S532P possibly damaging Het
Mob3a A T 10: 80,690,012 I155N probably damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Nrp1 G T 8: 128,432,023 V264L probably benign Het
Oas1a T C 5: 120,897,017 E360G probably benign Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr671 A T 7: 104,975,873 Y41* probably null Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Pcsk2 A T 2: 143,813,530 K545* probably null Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Pygo2 T C 3: 89,432,928 L211P possibly damaging Het
Rbbp6 C T 7: 122,985,245 T161I probably damaging Het
Rcsd1 A T 1: 165,655,342 I390N probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Ryr3 A T 2: 112,775,664 L2417Q probably damaging Het
Ryr3 C T 2: 112,875,077 E831K probably damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Sirt6 A G 10: 81,622,406 probably null Het
Slain1 C A 14: 103,688,346 Q377K possibly damaging Het
Slc30a6 T G 17: 74,423,023 S303A probably damaging Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Vmn1r91 T A 7: 20,101,293 S46T possibly damaging Het
Ybx3 T C 6: 131,384,506 N100S probably benign Het
Zfp747 A G 7: 127,374,053 L315P probably benign Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 splice site probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGGCATTCTTTCACAGGAC -3'
(R):5'- CTCGGAATGCCATCTCAAATG -3'

Sequencing Primer
(F):5'- GCATTCTTTCACAGGACCTAGTAGG -3'
(R):5'- GATTCCGCCTGCTGACACTG -3'
Posted On2020-01-23