Incidental Mutation 'R8043:Oas1a'
ID618620
Institutional Source Beutler Lab
Gene Symbol Oas1a
Ensembl Gene ENSMUSG00000052776
Gene Name2'-5' oligoadenylate synthetase 1A
SynonymsL3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8043 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120896256-120907521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120897017 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 360 (E360G)
Ref Sequence ENSEMBL: ENSMUSP00000079198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080322]
Predicted Effect probably benign
Transcript: ENSMUST00000080322
AA Change: E360G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079198
Gene: ENSMUSG00000052776
AA Change: E360G

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 9.8e-14 PFAM
Pfam:OAS1_C 164 349 1.9e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Atl1 T C 12: 69,959,215 Y432H probably damaging Het
Cacnb4 C T 2: 52,465,651 V215M probably damaging Het
Cep170 C T 1: 176,769,242 M516I probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Col6a6 A T 9: 105,699,020 V2047E probably damaging Het
Coro1c C T 5: 113,865,759 silent Het
Cplx4 A T 18: 65,957,119 probably null Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Epha5 A G 5: 84,233,654 V446A probably benign Het
Esam T C 9: 37,537,021 V252A probably damaging Het
F13b T G 1: 139,522,448 M616R probably benign Het
Fbxw21 T C 9: 109,146,626 Y234C probably benign Het
Fshr C T 17: 88,986,390 E287K probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Gpr3 G A 4: 133,210,960 R134C probably damaging Het
Greb1 T C 12: 16,711,789 E530G probably damaging Het
Hmgcs2 C T 3: 98,291,128 R116C probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kcnq5 T A 1: 21,479,420 Q361L probably damaging Het
Lrrc40 T C 3: 158,063,760 S532P possibly damaging Het
Mob3a A T 10: 80,690,012 I155N probably damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Nrp1 G T 8: 128,432,023 V264L probably benign Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr671 A T 7: 104,975,873 Y41* probably null Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Pcsk2 A T 2: 143,813,530 K545* probably null Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Pygo2 T C 3: 89,432,928 L211P possibly damaging Het
Rbbp6 C T 7: 122,985,245 T161I probably damaging Het
Rcsd1 A T 1: 165,655,342 I390N probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Ryr3 A T 2: 112,775,664 L2417Q probably damaging Het
Ryr3 C T 2: 112,875,077 E831K probably damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Sirt6 A G 10: 81,622,406 probably null Het
Slain1 C A 14: 103,688,346 Q377K possibly damaging Het
Slc30a6 T G 17: 74,423,023 S303A probably damaging Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Vmn1r91 T A 7: 20,101,293 S46T possibly damaging Het
Ybx3 T C 6: 131,384,506 N100S probably benign Het
Zfp747 A G 7: 127,374,053 L315P probably benign Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Oas1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Oas1a APN 5 120899214 missense probably benign 0.01
IGL02299:Oas1a APN 5 120905692 missense probably benign
IGL02951:Oas1a APN 5 120905664 missense probably damaging 1.00
IGL03112:Oas1a APN 5 120898349 missense possibly damaging 0.95
IGL03230:Oas1a APN 5 120898356 missense probably benign 0.23
IGL03356:Oas1a APN 5 120905845 missense probably damaging 0.99
IGL03379:Oas1a APN 5 120896999 missense possibly damaging 0.70
R0625:Oas1a UTSW 5 120899259 missense probably damaging 1.00
R1279:Oas1a UTSW 5 120897178 critical splice donor site probably null
R1914:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R1915:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R4758:Oas1a UTSW 5 120907338 missense probably damaging 1.00
R4928:Oas1a UTSW 5 120905724 missense probably benign
R5267:Oas1a UTSW 5 120899221 missense probably benign 0.00
R5442:Oas1a UTSW 5 120897206 missense probably benign 0.00
R5487:Oas1a UTSW 5 120907427 missense probably damaging 1.00
R6853:Oas1a UTSW 5 120907428 missense possibly damaging 0.95
R6880:Oas1a UTSW 5 120901940 missense probably damaging 0.97
R7953:Oas1a UTSW 5 120897017 missense probably benign 0.32
R8363:Oas1a UTSW 5 120905839 missense probably damaging 1.00
R8738:Oas1a UTSW 5 120901956 missense probably damaging 1.00
R8863:Oas1a UTSW 5 120905880 missense probably damaging 1.00
Z1177:Oas1a UTSW 5 120901895 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCCTTCTGAATCTGTTGAGGAAGG -3'
(R):5'- TTCATTGCAGACGGTGGTTC -3'

Sequencing Primer
(F):5'- AATCTGTTGAGGAAGGCTGGC -3'
(R):5'- AGACGGTGGTTCCTGTACC -3'
Posted On2020-01-23