Incidental Mutation 'R0661:BC051142'
ID61863
Institutional Source Beutler Lab
Gene Symbol BC051142
Ensembl Gene ENSMUSG00000057246
Gene NamecDNA sequence BC051142
Synonyms
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R0661 (G1)
Quality Score133
Status Not validated
Chromosome17
Chromosomal Location34398820-34460734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34459913 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 217 (I217F)
Ref Sequence ENSEMBL: ENSMUSP00000094961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078615] [ENSMUST00000097348] [ENSMUST00000114175]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078615
AA Change: I210F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077685
Gene: ENSMUSG00000057246
AA Change: I210F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 246 272 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 364 391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097348
AA Change: I217F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094961
Gene: ENSMUSG00000057246
AA Change: I217F

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 151 174 N/A INTRINSIC
low complexity region 253 279 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 371 398 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114175
AA Change: I200F

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109812
Gene: ENSMUSG00000057246
AA Change: I200F

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 142 165 N/A INTRINSIC
SCOP:d1i7qa_ 227 277 5e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000223765
AA Change: I217F
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in BC051142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:BC051142 APN 17 34420420 unclassified probably benign
IGL01516:BC051142 APN 17 34449260 missense possibly damaging 0.90
FR4304:BC051142 UTSW 17 34460055 unclassified probably benign
FR4304:BC051142 UTSW 17 34460077 unclassified probably benign
FR4340:BC051142 UTSW 17 34460060 nonsense probably null
FR4340:BC051142 UTSW 17 34460068 unclassified probably benign
FR4340:BC051142 UTSW 17 34460077 unclassified probably benign
FR4548:BC051142 UTSW 17 34460065 unclassified probably benign
FR4589:BC051142 UTSW 17 34460053 unclassified probably benign
FR4589:BC051142 UTSW 17 34460073 unclassified probably benign
FR4737:BC051142 UTSW 17 34460051 unclassified probably benign
FR4737:BC051142 UTSW 17 34460068 unclassified probably benign
FR4976:BC051142 UTSW 17 34460058 unclassified probably benign
FR4976:BC051142 UTSW 17 34460061 unclassified probably benign
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0523:BC051142 UTSW 17 34445499 critical splice donor site probably null
R2224:BC051142 UTSW 17 34448763 splice site probably null
R2937:BC051142 UTSW 17 34421862 missense possibly damaging 0.92
R3932:BC051142 UTSW 17 34443443 missense possibly damaging 0.94
R4210:BC051142 UTSW 17 34460283 unclassified probably benign
R4924:BC051142 UTSW 17 34459977 missense probably damaging 0.96
R5055:BC051142 UTSW 17 34448796 missense possibly damaging 0.83
R5446:BC051142 UTSW 17 34440893 splice site probably null
R6147:BC051142 UTSW 17 34418923 missense possibly damaging 0.95
R6851:BC051142 UTSW 17 34460172 missense possibly damaging 0.66
R6866:BC051142 UTSW 17 34459961 missense possibly damaging 0.66
R7035:BC051142 UTSW 17 34460331 unclassified probably benign
R7077:BC051142 UTSW 17 34440882 missense possibly damaging 0.82
R7468:BC051142 UTSW 17 34417565 intron probably null
R7556:BC051142 UTSW 17 34437717 missense unknown
R7843:BC051142 UTSW 17 34449824 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGTGGCGGGTTCCTCCCTATTAC -3'
(R):5'- TGCTGATGCTGATGCTGATGAGAAG -3'

Sequencing Primer
(F):5'- CTTCCAGGTCACTGAAGAGAGTC -3'
(R):5'- ctgatgctgatgAGAAGAGGAAG -3'
Posted On2013-07-30