Incidental Mutation 'R8043:Greb1'
ID618641
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8043 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16711789 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 530 (E530G)
Ref Sequence ENSEMBL: ENSMUSP00000044454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: E530G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: E530G

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159120
AA Change: E530G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: E530G

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160347
SMART Domains Protein: ENSMUSP00000124897
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 121 4.5e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160627
SMART Domains Protein: ENSMUSP00000124922
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 122 1.8e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: E530G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: E530G

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Atl1 T C 12: 69,959,215 Y432H probably damaging Het
Cacnb4 C T 2: 52,465,651 V215M probably damaging Het
Cep170 C T 1: 176,769,242 M516I probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Col6a6 A T 9: 105,699,020 V2047E probably damaging Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Epha5 A G 5: 84,233,654 V446A probably benign Het
Esam T C 9: 37,537,021 V252A probably damaging Het
F13b T G 1: 139,522,448 M616R probably benign Het
Fbxw21 T C 9: 109,146,626 Y234C probably benign Het
Fshr C T 17: 88,986,390 E287K probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Gpr3 G A 4: 133,210,960 R134C probably damaging Het
Hmgcs2 C T 3: 98,291,128 R116C probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kcnq5 T A 1: 21,479,420 Q361L probably damaging Het
Lrrc40 T C 3: 158,063,760 S532P possibly damaging Het
Mob3a A T 10: 80,690,012 I155N probably damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Nrp1 G T 8: 128,432,023 V264L probably benign Het
Oas1a T C 5: 120,897,017 E360G probably benign Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr671 A T 7: 104,975,873 Y41* probably null Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Pcsk2 A T 2: 143,813,530 K545* probably null Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Pygo2 T C 3: 89,432,928 L211P possibly damaging Het
Rbbp6 C T 7: 122,985,245 T161I probably damaging Het
Rcsd1 A T 1: 165,655,342 I390N probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Ryr3 A T 2: 112,775,664 L2417Q probably damaging Het
Ryr3 C T 2: 112,875,077 E831K probably damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Sirt6 A G 10: 81,622,406 probably null Het
Slain1 C A 14: 103,688,346 Q377K possibly damaging Het
Slc30a6 T G 17: 74,423,023 S303A probably damaging Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Vmn1r91 T A 7: 20,101,293 S46T possibly damaging Het
Ybx3 T C 6: 131,384,506 N100S probably benign Het
Zfp747 A G 7: 127,374,053 L315P probably benign Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGACTCACTCTTTTGGGAG -3'
(R):5'- CTGGAGCAGATCTTCCTACG -3'

Sequencing Primer
(F):5'- CTTTTGGGAGACTGGGCAATCAATAG -3'
(R):5'- TGGCGAGAGTCACACCTGAC -3'
Posted On2020-01-23