Incidental Mutation 'R8043:Atl1'
ID618642
Institutional Source Beutler Lab
Gene Symbol Atl1
Ensembl Gene ENSMUSG00000021066
Gene Nameatlastin GTPase 1
SynonymsAD-FSP, Spg3a, FSP1, SPG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R8043 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69892614-69966417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69959215 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 432 (Y432H)
Ref Sequence ENSEMBL: ENSMUSP00000021466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021466]
Predicted Effect probably damaging
Transcript: ENSMUST00000021466
AA Change: Y432H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: Y432H

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:GBP 43 314 2.3e-103 PFAM
low complexity region 350 363 N/A INTRINSIC
Blast:HAMP 468 519 9e-8 BLAST
Meta Mutation Damage Score 0.4833 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,073,602 Y628C probably damaging Het
Alpk2 C T 18: 65,349,830 C369Y probably damaging Het
Cacnb4 C T 2: 52,465,651 V215M probably damaging Het
Cep170 C T 1: 176,769,242 M516I probably damaging Het
Cep83 A C 10: 94,737,942 N231T probably damaging Het
Cfap44 G A 16: 44,413,691 G338D probably benign Het
Col6a6 A T 9: 105,699,020 V2047E probably damaging Het
Coro1c C T 5: 113,865,759 silent Het
Cplx4 A T 18: 65,957,119 probably null Het
Csf1r G C 18: 61,124,875 G639R probably damaging Het
Epha5 A G 5: 84,233,654 V446A probably benign Het
Esam T C 9: 37,537,021 V252A probably damaging Het
F13b T G 1: 139,522,448 M616R probably benign Het
Fbxw21 T C 9: 109,146,626 Y234C probably benign Het
Fshr C T 17: 88,986,390 E287K probably benign Het
Fstl4 T C 11: 53,000,223 S63P probably benign Het
Glra1 G A 11: 55,533,862 P174L probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Golga7 A T 8: 23,256,715 C24S possibly damaging Het
Gpr3 G A 4: 133,210,960 R134C probably damaging Het
Greb1 T C 12: 16,711,789 E530G probably damaging Het
Hmgcs2 C T 3: 98,291,128 R116C probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kcnq5 T A 1: 21,479,420 Q361L probably damaging Het
Lrrc40 T C 3: 158,063,760 S532P possibly damaging Het
Mob3a A T 10: 80,690,012 I155N probably damaging Het
Mpi A T 9: 57,550,598 L107Q probably damaging Het
Npffr2 G A 5: 89,582,654 V148I probably benign Het
Nrp1 G T 8: 128,432,023 V264L probably benign Het
Oas1a T C 5: 120,897,017 E360G probably benign Het
Olfr1446 A C 19: 12,889,731 V282G probably damaging Het
Olfr671 A T 7: 104,975,873 Y41* probably null Het
Olfr726 A T 14: 50,083,910 I257N possibly damaging Het
Pcdha2 A G 18: 36,939,526 D70G probably benign Het
Pcsk2 A T 2: 143,813,530 K545* probably null Het
Phf11b T C 14: 59,331,273 S64G probably benign Het
Pygo2 T C 3: 89,432,928 L211P possibly damaging Het
Rbbp6 C T 7: 122,985,245 T161I probably damaging Het
Rcsd1 A T 1: 165,655,342 I390N probably benign Het
Rpl21 T C 5: 146,835,892 V141A probably benign Het
Rufy3 C A 5: 88,642,992 D517E probably benign Het
Ryr3 A T 2: 112,775,664 L2417Q probably damaging Het
Ryr3 C T 2: 112,875,077 E831K probably damaging Het
Sipa1l1 A C 12: 82,449,926 Q1744P probably damaging Het
Sirt6 A G 10: 81,622,406 probably null Het
Slain1 C A 14: 103,688,346 Q377K possibly damaging Het
Slc30a6 T G 17: 74,423,023 S303A probably damaging Het
Sorcs3 T A 19: 48,764,295 L843Q possibly damaging Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Vmn1r91 T A 7: 20,101,293 S46T possibly damaging Het
Ybx3 T C 6: 131,384,506 N100S probably benign Het
Zfp747 A G 7: 127,374,053 L315P probably benign Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Atl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Atl1 APN 12 69932238 missense probably damaging 0.99
IGL02035:Atl1 APN 12 69960544 unclassified probably benign
IGL02229:Atl1 APN 12 69926025 missense probably benign 0.01
IGL03282:Atl1 APN 12 69954464 missense possibly damaging 0.87
IGL03374:Atl1 APN 12 69955367 missense probably damaging 1.00
R1538:Atl1 UTSW 12 69926188 missense probably benign 0.02
R1819:Atl1 UTSW 12 69963300 missense probably benign
R1903:Atl1 UTSW 12 69959275 missense probably damaging 0.98
R1961:Atl1 UTSW 12 69953500 missense probably benign 0.00
R1990:Atl1 UTSW 12 69963328 missense probably damaging 1.00
R2126:Atl1 UTSW 12 69931657 splice site probably null
R3724:Atl1 UTSW 12 69959380 missense probably damaging 0.99
R4402:Atl1 UTSW 12 69959199 missense probably benign 0.09
R5241:Atl1 UTSW 12 69959113 missense possibly damaging 0.52
R5256:Atl1 UTSW 12 69959333 missense probably damaging 1.00
R5285:Atl1 UTSW 12 69954499 missense probably benign 0.18
R5866:Atl1 UTSW 12 69926011 missense probably damaging 0.98
R6001:Atl1 UTSW 12 69932283 missense possibly damaging 0.92
R6434:Atl1 UTSW 12 69959425 nonsense probably null
R6677:Atl1 UTSW 12 69953444 missense probably damaging 0.99
R6728:Atl1 UTSW 12 69947550 missense possibly damaging 0.95
R6974:Atl1 UTSW 12 69926039 missense probably damaging 0.99
R7013:Atl1 UTSW 12 69953440 missense probably damaging 1.00
R7121:Atl1 UTSW 12 69931634 missense probably damaging 0.99
R7224:Atl1 UTSW 12 69955353 missense probably benign
R7437:Atl1 UTSW 12 69931622 missense probably benign 0.37
R8319:Atl1 UTSW 12 69955319 missense probably damaging 0.99
Z1176:Atl1 UTSW 12 69937075 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GAAGCCTCTCTTTCTGACAGG -3'
(R):5'- TCTCGATATTCGCCAGAGTAGC -3'

Sequencing Primer
(F):5'- ACAGGTTTGTGGTGGTGATAAACC -3'
(R):5'- CCAGAGTAGCGGATATATGCCC -3'
Posted On2020-01-23