Mutagenetix > Incidental Mutations

Incidental Mutation 'R8043:Atl1'

618642

Institutional Source

Beutler Lab

Gene Symbol

Atl1

Ensembl Gene

ENSMUSG00000021066

Gene Name

atlastin GTPase 1

Synonyms

AD-FSP, Spg3a, FSP1, SPG3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.419) question?

Stock #

R8043 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69892614-69966417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69959215 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 432 (Y432H)

Ref Sequence

ENSEMBL: ENSMUSP00000021466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021466]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021466
AA Change: Y432H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: Y432H

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:GBP	43	314	2.3e-103	PFAM
low complexity region	350	363	N/A	INTRINSIC
Blast:HAMP	468	519	9e-8	BLAST

Meta Mutation Damage Score

0.4833

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,073,602	Y628C	probably damaging	Het
Alpk2	C	T	18: 65,349,830	C369Y	probably damaging	Het
Cacnb4	C	T	2: 52,465,651	V215M	probably damaging	Het
Cep170	C	T	1: 176,769,242	M516I	probably damaging	Het
Cep83	A	C	10: 94,737,942	N231T	probably damaging	Het
Cfap44	G	A	16: 44,413,691	G338D	probably benign	Het
Col6a6	A	T	9: 105,699,020	V2047E	probably damaging	Het
Coro1c	C	T	5: 113,865,759		silent	Het
Cplx4	A	T	18: 65,957,119		probably null	Het
Csf1r	G	C	18: 61,124,875	G639R	probably damaging	Het
Epha5	A	G	5: 84,233,654	V446A	probably benign	Het
Esam	T	C	9: 37,537,021	V252A	probably damaging	Het
F13b	T	G	1: 139,522,448	M616R	probably benign	Het
Fbxw21	T	C	9: 109,146,626	Y234C	probably benign	Het
Fshr	C	T	17: 88,986,390	E287K	probably benign	Het
Fstl4	T	C	11: 53,000,223	S63P	probably benign	Het
Glra1	G	A	11: 55,533,862	P174L	probably damaging	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Golga7	A	T	8: 23,256,715	C24S	possibly damaging	Het
Gpr3	G	A	4: 133,210,960	R134C	probably damaging	Het
Greb1	T	C	12: 16,711,789	E530G	probably damaging	Het
Hmgcs2	C	T	3: 98,291,128	R116C	probably damaging	Het
Kcnj9	C	A	1: 172,326,056	R167L	probably damaging	Het
Kcnq5	T	A	1: 21,479,420	Q361L	probably damaging	Het
Lrrc40	T	C	3: 158,063,760	S532P	possibly damaging	Het
Mob3a	A	T	10: 80,690,012	I155N	probably damaging	Het
Mpi	A	T	9: 57,550,598	L107Q	probably damaging	Het
Npffr2	G	A	5: 89,582,654	V148I	probably benign	Het
Nrp1	G	T	8: 128,432,023	V264L	probably benign	Het
Oas1a	T	C	5: 120,897,017	E360G	probably benign	Het
Olfr1446	A	C	19: 12,889,731	V282G	probably damaging	Het
Olfr671	A	T	7: 104,975,873	Y41*	probably null	Het
Olfr726	A	T	14: 50,083,910	I257N	possibly damaging	Het
Pcdha2	A	G	18: 36,939,526	D70G	probably benign	Het
Pcsk2	A	T	2: 143,813,530	K545*	probably null	Het
Phf11b	T	C	14: 59,331,273	S64G	probably benign	Het
Pygo2	T	C	3: 89,432,928	L211P	possibly damaging	Het
Rbbp6	C	T	7: 122,985,245	T161I	probably damaging	Het
Rcsd1	A	T	1: 165,655,342	I390N	probably benign	Het
Rpl21	T	C	5: 146,835,892	V141A	probably benign	Het
Rufy3	C	A	5: 88,642,992	D517E	probably benign	Het
Ryr3	A	T	2: 112,775,664	L2417Q	probably damaging	Het
Ryr3	C	T	2: 112,875,077	E831K	probably damaging	Het
Sipa1l1	A	C	12: 82,449,926	Q1744P	probably damaging	Het
Sirt6	A	G	10: 81,622,406		probably null	Het
Slain1	C	A	14: 103,688,346	Q377K	possibly damaging	Het
Slc30a6	T	G	17: 74,423,023	S303A	probably damaging	Het
Sorcs3	T	A	19: 48,764,295	L843Q	possibly damaging	Het
Usp45	G	A	4: 21,824,543	A432T	probably benign	Het
Vmn1r91	T	A	7: 20,101,293	S46T	possibly damaging	Het
Ybx3	T	C	6: 131,384,506	N100S	probably benign	Het
Zfp747	A	G	7: 127,374,053	L315P	probably benign	Het
Zfp750	T	C	11: 121,511,880	T681A	probably benign	Het

Other mutations in Atl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00824:Atl1	APN	12	69932238	missense	probably damaging	0.99
IGL02035:Atl1	APN	12	69960544	unclassified	probably benign
IGL02229:Atl1	APN	12	69926025	missense	probably benign	0.01
IGL03282:Atl1	APN	12	69954464	missense	possibly damaging	0.87
IGL03374:Atl1	APN	12	69955367	missense	probably damaging	1.00
R1538:Atl1	UTSW	12	69926188	missense	probably benign	0.02
R1819:Atl1	UTSW	12	69963300	missense	probably benign
R1903:Atl1	UTSW	12	69959275	missense	probably damaging	0.98
R1961:Atl1	UTSW	12	69953500	missense	probably benign	0.00
R1990:Atl1	UTSW	12	69963328	missense	probably damaging	1.00
R2126:Atl1	UTSW	12	69931657	splice site	probably null
R3724:Atl1	UTSW	12	69959380	missense	probably damaging	0.99
R4402:Atl1	UTSW	12	69959199	missense	probably benign	0.09
R5241:Atl1	UTSW	12	69959113	missense	possibly damaging	0.52
R5256:Atl1	UTSW	12	69959333	missense	probably damaging	1.00
R5285:Atl1	UTSW	12	69954499	missense	probably benign	0.18
R5866:Atl1	UTSW	12	69926011	missense	probably damaging	0.98
R6001:Atl1	UTSW	12	69932283	missense	possibly damaging	0.92
R6434:Atl1	UTSW	12	69959425	nonsense	probably null
R6677:Atl1	UTSW	12	69953444	missense	probably damaging	0.99
R6728:Atl1	UTSW	12	69947550	missense	possibly damaging	0.95
R6974:Atl1	UTSW	12	69926039	missense	probably damaging	0.99
R7013:Atl1	UTSW	12	69953440	missense	probably damaging	1.00
R7121:Atl1	UTSW	12	69931634	missense	probably damaging	0.99
R7224:Atl1	UTSW	12	69955353	missense	probably benign
R7437:Atl1	UTSW	12	69931622	missense	probably benign	0.37
R8319:Atl1	UTSW	12	69955319	missense	probably damaging	0.99
Z1176:Atl1	UTSW	12	69937075	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GAAGCCTCTCTTTCTGACAGG -3'
(R):5'- TCTCGATATTCGCCAGAGTAGC -3'

Sequencing Primer
(F):5'- ACAGGTTTGTGGTGGTGATAAACC -3'
(R):5'- CCAGAGTAGCGGATATATGCCC -3'

Posted On

2020-01-23