Incidental Mutation 'R8044:Ptpra'
ID618657
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Nameprotein tyrosine phosphatase, receptor type, A
SynonymsPTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8044 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130450278-130556124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130544961 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 627 (K627E)
Ref Sequence ENSEMBL: ENSMUSP00000076533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303]
PDB Structure
Crystal structure of the D2 domain of RPTPa [X-RAY DIFFRACTION]
RECEPTOR PROTEIN TYROSINE PHOSPHATASE ALPHA, DOMAIN 1 FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028769
AA Change: K591E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: K591E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077303
AA Change: K627E

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: K627E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik T C 8: 85,412,118 E114G possibly damaging Het
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apbb1 GTCCTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTCCTC 7: 105,573,887 probably benign Het
Asb7 T C 7: 66,659,763 N235S probably benign Het
Atrn A T 2: 130,935,529 N166I probably damaging Het
C87499 T G 4: 88,629,975 E64D possibly damaging Het
Cd300ld2 C T 11: 115,013,719 W107* probably null Het
Chl1 A T 6: 103,706,632 E806D probably damaging Het
Dnajb12 A G 10: 59,896,350 K337R possibly damaging Het
Dock5 T C 14: 67,824,692 D409G probably damaging Het
Efhb G A 17: 53,399,115 S798L probably benign Het
Gpd1 T C 15: 99,723,202 F322S probably damaging Het
Gria4 A G 9: 4,456,216 Y695H probably damaging Het
Ipo8 A G 6: 148,809,923 F289S probably damaging Het
Jakmip1 A G 5: 37,154,644 E72G unknown Het
Mettl14 T C 3: 123,369,660 N366S probably benign Het
Ntrk2 A G 13: 59,126,499 T730A probably damaging Het
Olfr1453 T C 19: 13,027,465 Y288C probably damaging Het
Otop3 T C 11: 115,346,435 L575P probably damaging Het
Piwil2 T C 14: 70,391,438 S710G possibly damaging Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rpe65 T C 3: 159,614,705 F300L probably benign Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tert A G 13: 73,635,449 E590G probably damaging Het
Tlr4 C A 4: 66,827,847 L6I probably benign Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Ube3a A T 7: 59,276,572 H387L possibly damaging Het
Ugt1a7c G A 1: 88,095,556 V146M probably damaging Het
Upf2 T C 2: 6,029,438 I974T unknown Het
Vmn1r38 A T 6: 66,776,532 I200N probably benign Het
Wnt5b A G 6: 119,446,358 V115A probably damaging Het
Xpo7 C A 14: 70,684,926 R574L probably benign Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130544439 missense probably damaging 1.00
IGL01734:Ptpra APN 2 130544077 missense probably damaging 1.00
IGL02218:Ptpra APN 2 130552335 splice site probably benign
IGL02385:Ptpra APN 2 130540473 unclassified probably benign
IGL02480:Ptpra APN 2 130504261 missense probably benign 0.09
IGL03181:Ptpra APN 2 130517787 missense probably damaging 0.99
R0374:Ptpra UTSW 2 130537621 missense probably damaging 1.00
R0483:Ptpra UTSW 2 130539685 missense probably damaging 1.00
R0848:Ptpra UTSW 2 130518991 missense probably damaging 1.00
R1550:Ptpra UTSW 2 130541393 missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130544952 missense probably damaging 1.00
R1689:Ptpra UTSW 2 130503492 missense probably benign 0.01
R1760:Ptpra UTSW 2 130549827 missense probably damaging 1.00
R1943:Ptpra UTSW 2 130544104 missense probably damaging 1.00
R2114:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2115:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2117:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2187:Ptpra UTSW 2 130504299 missense probably benign
R2848:Ptpra UTSW 2 130544999 missense probably benign 0.06
R2849:Ptpra UTSW 2 130544999 missense probably benign 0.06
R4644:Ptpra UTSW 2 130544158 missense probably damaging 1.00
R4779:Ptpra UTSW 2 130537617 missense probably damaging 1.00
R4849:Ptpra UTSW 2 130532161 missense probably damaging 1.00
R4899:Ptpra UTSW 2 130544436 missense probably damaging 1.00
R5657:Ptpra UTSW 2 130504284 missense probably benign 0.06
R6018:Ptpra UTSW 2 130503502 missense probably benign
R6234:Ptpra UTSW 2 130537588 missense probably damaging 1.00
R6350:Ptpra UTSW 2 130540592 missense probably damaging 1.00
R6856:Ptpra UTSW 2 130519381 missense probably damaging 1.00
R7072:Ptpra UTSW 2 130553430 missense probably damaging 1.00
R7146:Ptpra UTSW 2 130537651 critical splice donor site probably null
R7220:Ptpra UTSW 2 130544497 missense probably damaging 1.00
R7346:Ptpra UTSW 2 130553400 missense probably damaging 1.00
R7819:Ptpra UTSW 2 130504206 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGATCCTTCCTCAAAAGAGAGC -3'
(R):5'- GCTTAGACACCAACTGCTGC -3'

Sequencing Primer
(F):5'- AAGAGAGCTCTTTGTGGAATCTGTC -3'
(R):5'- GATTCAAACATACCTTACGGTTGCC -3'
Posted On2020-01-23