Incidental Mutation 'R0661:Olfr1431'
ID61866
Institutional Source Beutler Lab
Gene Symbol Olfr1431
Ensembl Gene ENSMUSG00000094133
Gene Nameolfactory receptor 1431
SynonymsGA_x6K02T2RE5P-2573738-2574676, MOR214-5
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R0661 (G1)
Quality Score86
Status Not validated
Chromosome19
Chromosomal Location12200634-12212191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12209704 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 46 (L46P)
Ref Sequence ENSEMBL: ENSMUSP00000150967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072316] [ENSMUST00000213759]
Predicted Effect probably damaging
Transcript: ENSMUST00000072316
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072158
Gene: ENSMUSG00000094133
AA Change: L46P

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.4e-56 PFAM
Pfam:7tm_1 42 309 2.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213759
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214138
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Olfr1431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Olfr1431 APN 19 12210040 missense possibly damaging 0.65
IGL02206:Olfr1431 APN 19 12210460 missense probably damaging 1.00
IGL02938:Olfr1431 APN 19 12209682 missense probably benign 0.00
PIT4812001:Olfr1431 UTSW 19 12210253 missense probably damaging 1.00
R0402:Olfr1431 UTSW 19 12209589 missense probably damaging 1.00
R1193:Olfr1431 UTSW 19 12210439 missense probably damaging 1.00
R1483:Olfr1431 UTSW 19 12209750 nonsense probably null
R4091:Olfr1431 UTSW 19 12209779 missense probably damaging 1.00
R4280:Olfr1431 UTSW 19 12209938 missense probably damaging 1.00
R5028:Olfr1431 UTSW 19 12210154 missense possibly damaging 0.94
R5540:Olfr1431 UTSW 19 12210460 missense probably damaging 1.00
R6042:Olfr1431 UTSW 19 12209922 missense probably damaging 0.99
R6045:Olfr1431 UTSW 19 12210295 missense probably damaging 1.00
R7104:Olfr1431 UTSW 19 12209878 missense possibly damaging 0.82
Z1088:Olfr1431 UTSW 19 12210490 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTGGCATCAAGGAACTACCTGCTTC -3'
(R):5'- GGCAACATTCAGTCAGCCCCATAG -3'

Sequencing Primer
(F):5'- TGTCACTAGAGTCAGCAATGC -3'
(R):5'- CAGTCAGCCCCATAGTGGAAAG -3'
Posted On2013-07-30