Incidental Mutation 'R8044:Tlr4'
ID618661
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8044 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66827847 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 6 (L6I)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048096
AA Change: L6I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: L6I

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
AA Change: L6I

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005
AA Change: L6I

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik T C 8: 85,412,118 E114G possibly damaging Het
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Asb7 T C 7: 66,659,763 N235S probably benign Het
Atrn A T 2: 130,935,529 N166I probably damaging Het
C87499 T G 4: 88,629,975 E64D possibly damaging Het
Cd300ld2 C T 11: 115,013,719 W107* probably null Het
Chl1 A T 6: 103,706,632 E806D probably damaging Het
Dnajb12 A G 10: 59,896,350 K337R possibly damaging Het
Dock5 T C 14: 67,824,692 D409G probably damaging Het
Efhb G A 17: 53,399,115 S798L probably benign Het
Gpd1 T C 15: 99,723,202 F322S probably damaging Het
Gria4 A G 9: 4,456,216 Y695H probably damaging Het
Ipo8 A G 6: 148,809,923 F289S probably damaging Het
Jakmip1 A G 5: 37,154,644 E72G unknown Het
Mettl14 T C 3: 123,369,660 N366S probably benign Het
Ntrk2 A G 13: 59,126,499 T730A probably damaging Het
Olfr1453 T C 19: 13,027,465 Y288C probably damaging Het
Otop3 T C 11: 115,346,435 L575P probably damaging Het
Piwil2 T C 14: 70,391,438 S710G possibly damaging Het
Ptpra A G 2: 130,544,961 K627E possibly damaging Het
Rab24 A G 13: 55,321,532 probably benign Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rpe65 T C 3: 159,614,705 F300L probably benign Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tert A G 13: 73,635,449 E590G probably damaging Het
Trim3 G A 7: 105,613,258 silent Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Ube3a A T 7: 59,276,572 H387L possibly damaging Het
Ugt1a7c G A 1: 88,095,556 V146M probably damaging Het
Upf2 T C 2: 6,029,438 I974T unknown Het
Vmn1r38 A T 6: 66,776,532 I200N probably benign Het
Wnt5b A G 6: 119,446,358 V115A probably damaging Het
Xpo7 C A 14: 70,684,926 R574L probably benign Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
Cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
salvador UTSW 4 66840206 missense probably damaging 0.99
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
R7139:Tlr4 UTSW 4 66840283 missense probably benign 0.06
R7199:Tlr4 UTSW 4 66841193 missense probably damaging 0.99
R7220:Tlr4 UTSW 4 66839951 missense probably benign
R7337:Tlr4 UTSW 4 66839954 missense possibly damaging 0.86
R7487:Tlr4 UTSW 4 66924422 missense probably benign 0.00
R7638:Tlr4 UTSW 4 66840206 missense probably damaging 0.99
R7773:Tlr4 UTSW 4 66839599 missense probably damaging 1.00
R7814:Tlr4 UTSW 4 66841079 missense probably damaging 1.00
R7897:Tlr4 UTSW 4 66839821 missense probably benign 0.07
R8062:Tlr4 UTSW 4 66839850 missense probably benign 0.00
R8080:Tlr4 UTSW 4 66839476 missense probably damaging 1.00
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTTGGCACTCTCACTTC -3'
(R):5'- TTGTTGCCAAGGCTTCTCAAG -3'

Sequencing Primer
(F):5'- CCTCTTTGAATATAGTACTTGCAGAG -3'
(R):5'- GCCAAGGCTTCTCAAGTTTTTG -3'
Posted On2020-01-23