Incidental Mutation 'R0661:Ar'
ID61868
Institutional Source Beutler Lab
Gene Symbol Ar
Ensembl Gene ENSMUSG00000046532
Gene Nameandrogen receptor
Synonyms
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0661 (G1)
Quality Score119
Status Not validated
ChromosomeX
Chromosomal Location98148769-98323215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98150565 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 262 (Y262N)
Ref Sequence ENSEMBL: ENSMUSP00000052648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052837]
PDB Structure
AR LBD with small molecule [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000052837
AA Change: Y262N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052648
Gene: ENSMUSG00000046532
AA Change: Y262N

DomainStartEndE-ValueType
Pfam:Androgen_recep 6 442 5.4e-231 PFAM
ZnF_C4 536 607 3.34e-32 SMART
HOLI 686 850 1.04e-33 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear hormone receptor containing zinc finger and DNA-binding domains. The encoded protein is a key regulator of signalling by androgens, a class of steroid hormones involved in male reproductive development. The protein responds to hormone signalling by translocating to the nucleus, forming dimers, and binding to androgen response elements (AREs) in the promoters of target genes, which are subsequently transcriptionally activated. Activity of this protein is negatively regulated by nuclear receptor subfamily 0 group B member 1 (Nr0b1, also known as Dax1). Mutations in this gene result in feminized genitals and infertility in male animals. Loss of function in female animals also causes problems in reproductive development and function. [provided by RefSeq, May 2015]
PHENOTYPE: Hemizygous mutant males are androgen-resistant and therefore have small, undescended testes, and lack epididymal structures, vas deferens, and male accessory glands. They resemble females physically and behaviorally, but lack female reproductive organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Ar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01515:Ar APN X 98251847 splice site probably benign
IGL02178:Ar APN X 98305438 missense probably damaging 1.00
IGL02626:Ar APN X 98314886 missense probably damaging 0.99
R2224:Ar UTSW X 98151331 missense probably benign 0.19
R2226:Ar UTSW X 98151331 missense probably benign 0.19
R2227:Ar UTSW X 98151331 missense probably benign 0.19
Z1176:Ar UTSW X 98151009 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGCTCCGCCGACATTAAAGAC -3'
(R):5'- AAGTGTCCCAGAGCTACCTGCTTC -3'

Sequencing Primer
(F):5'- cagcagcagcaacaacag -3'
(R):5'- TTCACTGCTGCCAGAGCAC -3'
Posted On2013-07-30