Incidental Mutation 'R8044:Dock5'
ID 618680
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms 1110060D06Rik, rlc, lr2
MMRRC Submission 067481-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.389) question?
Stock # R8044 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67989584-68170891 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68062141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 409 (D409G)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably damaging
Transcript: ENSMUST00000039135
AA Change: D409G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: D409G

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik T C 8: 86,138,747 (GRCm39) E114G possibly damaging Het
Abcc4 ACCAGCCC ACC 14: 118,852,682 (GRCm39) probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Asb7 T C 7: 66,309,511 (GRCm39) N235S probably benign Het
Atrn A T 2: 130,777,449 (GRCm39) N166I probably damaging Het
Cd300ld2 C T 11: 114,904,545 (GRCm39) W107* probably null Het
Chl1 A T 6: 103,683,593 (GRCm39) E806D probably damaging Het
Dnajb12 A G 10: 59,732,172 (GRCm39) K337R possibly damaging Het
Efhb G A 17: 53,706,143 (GRCm39) S798L probably benign Het
Gpd1 T C 15: 99,621,083 (GRCm39) F322S probably damaging Het
Gria4 A G 9: 4,456,216 (GRCm39) Y695H probably damaging Het
Ipo8 A G 6: 148,711,421 (GRCm39) F289S probably damaging Het
Jakmip1 A G 5: 37,311,988 (GRCm39) E72G unknown Het
Mettl14 T C 3: 123,163,309 (GRCm39) N366S probably benign Het
Ntrk2 A G 13: 59,274,313 (GRCm39) T730A probably damaging Het
Or5b101 T C 19: 13,004,829 (GRCm39) Y288C probably damaging Het
Otop3 T C 11: 115,237,261 (GRCm39) L575P probably damaging Het
Piwil2 T C 14: 70,628,887 (GRCm39) S710G possibly damaging Het
Pramel32 T G 4: 88,548,212 (GRCm39) E64D possibly damaging Het
Ptpra A G 2: 130,386,881 (GRCm39) K627E possibly damaging Het
Rab24 A G 13: 55,469,345 (GRCm39) probably benign Het
Rbm20 C A 19: 53,806,402 (GRCm39) A494D probably benign Het
Rpe65 T C 3: 159,320,342 (GRCm39) F300L probably benign Het
St6gal1 G A 16: 23,176,585 (GRCm39) A393T probably benign Het
Tert A G 13: 73,783,568 (GRCm39) E590G probably damaging Het
Tlr4 C A 4: 66,746,084 (GRCm39) L6I probably benign Het
Trim3 G A 7: 105,262,465 (GRCm39) silent Het
Tubg1 G T 11: 101,014,854 (GRCm39) A199S probably benign Het
Ube3a A T 7: 58,926,320 (GRCm39) H387L possibly damaging Het
Ugt1a7c G A 1: 88,023,278 (GRCm39) V146M probably damaging Het
Upf2 T C 2: 6,034,249 (GRCm39) I974T unknown Het
Vmn1r38 A T 6: 66,753,516 (GRCm39) I200N probably benign Het
Wnt5b A G 6: 119,423,319 (GRCm39) V115A probably damaging Het
Xpo7 C A 14: 70,922,366 (GRCm39) R574L probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 68,024,338 (GRCm39) splice site probably benign
IGL00930:Dock5 APN 14 68,008,526 (GRCm39) missense probably damaging 1.00
IGL01525:Dock5 APN 14 68,043,169 (GRCm39) splice site probably benign
IGL01759:Dock5 APN 14 68,118,708 (GRCm39) nonsense probably null
IGL01941:Dock5 APN 14 68,049,681 (GRCm39) missense probably damaging 1.00
IGL02025:Dock5 APN 14 68,000,736 (GRCm39) missense probably damaging 1.00
IGL02093:Dock5 APN 14 68,076,992 (GRCm39) splice site probably benign
IGL02179:Dock5 APN 14 68,043,945 (GRCm39) splice site probably benign
IGL02208:Dock5 APN 14 68,065,899 (GRCm39) missense probably benign 0.06
IGL02605:Dock5 APN 14 68,065,887 (GRCm39) missense probably benign 0.18
IGL02608:Dock5 APN 14 68,065,888 (GRCm39) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,994,667 (GRCm39) splice site probably benign
IGL02971:Dock5 APN 14 67,994,558 (GRCm39) missense probably null 1.00
IGL02983:Dock5 APN 14 68,002,119 (GRCm39) missense probably damaging 1.00
IGL03151:Dock5 APN 14 68,103,516 (GRCm39) missense probably damaging 1.00
IGL03410:Dock5 APN 14 68,083,535 (GRCm39) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 68,062,123 (GRCm39) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 68,083,530 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0112:Dock5 UTSW 14 68,057,090 (GRCm39) missense probably benign
R0127:Dock5 UTSW 14 68,083,491 (GRCm39) missense probably benign 0.13
R0144:Dock5 UTSW 14 68,023,735 (GRCm39) missense probably benign 0.18
R0312:Dock5 UTSW 14 68,033,440 (GRCm39) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0364:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0496:Dock5 UTSW 14 68,054,967 (GRCm39) missense probably damaging 1.00
R0506:Dock5 UTSW 14 68,022,241 (GRCm39) splice site probably benign
R0586:Dock5 UTSW 14 68,046,481 (GRCm39) missense probably damaging 1.00
R0597:Dock5 UTSW 14 68,022,383 (GRCm39) splice site probably null
R0625:Dock5 UTSW 14 68,078,612 (GRCm39) missense probably benign
R1109:Dock5 UTSW 14 68,043,927 (GRCm39) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,996,610 (GRCm39) missense probably benign 0.00
R1278:Dock5 UTSW 14 68,077,015 (GRCm39) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 68,083,511 (GRCm39) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,994,584 (GRCm39) nonsense probably null
R1946:Dock5 UTSW 14 68,023,765 (GRCm39) missense probably damaging 1.00
R2046:Dock5 UTSW 14 68,049,591 (GRCm39) missense probably benign
R2101:Dock5 UTSW 14 68,031,459 (GRCm39) missense probably benign 0.02
R2252:Dock5 UTSW 14 68,022,261 (GRCm39) missense probably damaging 0.98
R2882:Dock5 UTSW 14 68,077,069 (GRCm39) missense probably damaging 0.99
R3110:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,993,941 (GRCm39) missense probably benign 0.02
R4242:Dock5 UTSW 14 68,065,939 (GRCm39) missense probably benign 0.19
R4244:Dock5 UTSW 14 68,012,031 (GRCm39) missense probably benign 0.41
R4646:Dock5 UTSW 14 68,080,228 (GRCm39) missense probably benign 0.01
R4793:Dock5 UTSW 14 68,037,803 (GRCm39) missense probably benign 0.26
R4841:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R4842:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R5159:Dock5 UTSW 14 68,029,738 (GRCm39) missense probably benign 0.04
R5164:Dock5 UTSW 14 68,055,110 (GRCm39) nonsense probably null
R5206:Dock5 UTSW 14 68,000,633 (GRCm39) missense probably benign 0.35
R5207:Dock5 UTSW 14 68,013,733 (GRCm39) missense probably benign 0.06
R5322:Dock5 UTSW 14 68,007,715 (GRCm39) missense probably benign 0.41
R5374:Dock5 UTSW 14 68,043,205 (GRCm39) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 68,002,104 (GRCm39) missense probably damaging 1.00
R5476:Dock5 UTSW 14 68,051,456 (GRCm39) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 68,040,535 (GRCm39) missense probably benign 0.01
R5677:Dock5 UTSW 14 68,015,052 (GRCm39) missense probably benign 0.00
R5773:Dock5 UTSW 14 68,033,507 (GRCm39) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 68,078,550 (GRCm39) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 68,095,443 (GRCm39) missense probably benign
R6154:Dock5 UTSW 14 68,097,361 (GRCm39) missense probably benign 0.03
R6268:Dock5 UTSW 14 68,027,724 (GRCm39) nonsense probably null
R6393:Dock5 UTSW 14 68,060,051 (GRCm39) missense probably benign 0.32
R6512:Dock5 UTSW 14 68,062,097 (GRCm39) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 68,033,445 (GRCm39) missense probably benign 0.00
R7012:Dock5 UTSW 14 68,060,035 (GRCm39) missense probably damaging 1.00
R7061:Dock5 UTSW 14 68,007,703 (GRCm39) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,993,919 (GRCm39) missense probably damaging 1.00
R7200:Dock5 UTSW 14 68,009,151 (GRCm39) nonsense probably null
R7311:Dock5 UTSW 14 68,065,951 (GRCm39) missense probably benign 0.25
R7359:Dock5 UTSW 14 68,003,337 (GRCm39) missense probably benign 0.10
R7422:Dock5 UTSW 14 68,046,479 (GRCm39) missense probably benign 0.01
R7588:Dock5 UTSW 14 68,000,607 (GRCm39) critical splice donor site probably null
R7637:Dock5 UTSW 14 68,023,789 (GRCm39) missense possibly damaging 0.95
R7709:Dock5 UTSW 14 68,033,454 (GRCm39) missense probably benign 0.44
R7763:Dock5 UTSW 14 68,058,776 (GRCm39) missense probably damaging 0.97
R8076:Dock5 UTSW 14 68,040,426 (GRCm39) splice site probably null
R8168:Dock5 UTSW 14 68,007,646 (GRCm39) splice site probably null
R8353:Dock5 UTSW 14 68,054,957 (GRCm39) splice site probably null
R8480:Dock5 UTSW 14 68,073,859 (GRCm39) missense probably benign 0.32
R8535:Dock5 UTSW 14 68,031,425 (GRCm39) missense probably benign 0.19
R8708:Dock5 UTSW 14 68,004,820 (GRCm39) missense probably benign 0.02
R8732:Dock5 UTSW 14 68,083,449 (GRCm39) missense possibly damaging 0.85
R8888:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 68,083,439 (GRCm39) nonsense probably null
R8962:Dock5 UTSW 14 67,994,640 (GRCm39) missense probably benign
R8972:Dock5 UTSW 14 68,013,749 (GRCm39) missense probably damaging 1.00
R9244:Dock5 UTSW 14 67,996,563 (GRCm39) missense probably damaging 0.99
R9345:Dock5 UTSW 14 68,060,071 (GRCm39) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 68,018,450 (GRCm39) missense probably damaging 1.00
X0023:Dock5 UTSW 14 68,008,537 (GRCm39) missense probably benign 0.15
Z1177:Dock5 UTSW 14 68,051,382 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAGGTAATCCTTTCTTCCAACATG -3'
(R):5'- TCAGGTAAGGAGGCCTCTTG -3'

Sequencing Primer
(F):5'- GTGTACCTGGCAGGATTA -3'
(R):5'- CCTCTTGTGAGTTTGAAGGAAAC -3'
Posted On 2020-01-23