Incidental Mutation 'R8044:St6gal1'
ID618685
Institutional Source Beutler Lab
Gene Symbol St6gal1
Ensembl Gene ENSMUSG00000022885
Gene Namebeta galactoside alpha 2,6 sialyltransferase 1
SynonymsSt6Gal-I, Siat1, ST6Gal I
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R8044 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location23224740-23360350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23357835 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 393 (A393T)
Ref Sequence ENSEMBL: ENSMUSP00000023601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023601] [ENSMUST00000115335] [ENSMUST00000178797]
Predicted Effect probably benign
Transcript: ENSMUST00000023601
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023601
Gene: ENSMUSG00000022885
AA Change: A393T

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115335
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110992
Gene: ENSMUSG00000022885
AA Change: A393T

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 140 383 8.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178797
AA Change: A393T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136206
Gene: ENSMUSG00000022885
AA Change: A393T

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Glyco_transf_29 127 389 2.3e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik T C 8: 85,412,118 E114G possibly damaging Het
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apbb1 GTCCTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTCCTC 7: 105,573,887 probably benign Het
Asb7 T C 7: 66,659,763 N235S probably benign Het
Atrn A T 2: 130,935,529 N166I probably damaging Het
C87499 T G 4: 88,629,975 E64D possibly damaging Het
Cd300ld2 C T 11: 115,013,719 W107* probably null Het
Chl1 A T 6: 103,706,632 E806D probably damaging Het
Dnajb12 A G 10: 59,896,350 K337R possibly damaging Het
Dock5 T C 14: 67,824,692 D409G probably damaging Het
Efhb G A 17: 53,399,115 S798L probably benign Het
Gpd1 T C 15: 99,723,202 F322S probably damaging Het
Gria4 A G 9: 4,456,216 Y695H probably damaging Het
Ipo8 A G 6: 148,809,923 F289S probably damaging Het
Jakmip1 A G 5: 37,154,644 E72G unknown Het
Mettl14 T C 3: 123,369,660 N366S probably benign Het
Ntrk2 A G 13: 59,126,499 T730A probably damaging Het
Olfr1453 T C 19: 13,027,465 Y288C probably damaging Het
Otop3 T C 11: 115,346,435 L575P probably damaging Het
Piwil2 T C 14: 70,391,438 S710G possibly damaging Het
Ptpra A G 2: 130,544,961 K627E possibly damaging Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rpe65 T C 3: 159,614,705 F300L probably benign Het
Tert A G 13: 73,635,449 E590G probably damaging Het
Tlr4 C A 4: 66,827,847 L6I probably benign Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Ube3a A T 7: 59,276,572 H387L possibly damaging Het
Ugt1a7c G A 1: 88,095,556 V146M probably damaging Het
Upf2 T C 2: 6,029,438 I974T unknown Het
Vmn1r38 A T 6: 66,776,532 I200N probably benign Het
Wnt5b A G 6: 119,446,358 V115A probably damaging Het
Xpo7 C A 14: 70,684,926 R574L probably benign Het
Other mutations in St6gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:St6gal1 APN 16 23356392 splice site probably benign
IGL01667:St6gal1 APN 16 23321424 missense probably benign 0.00
IGL01783:St6gal1 APN 16 23321555 missense probably benign 0.29
IGL02996:St6gal1 APN 16 23321154 missense probably damaging 0.98
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0049:St6gal1 UTSW 16 23321141 missense probably damaging 1.00
R0295:St6gal1 UTSW 16 23356203 splice site probably benign
R1290:St6gal1 UTSW 16 23321661 missense probably benign 0.03
R1352:St6gal1 UTSW 16 23321651 missense probably damaging 1.00
R1817:St6gal1 UTSW 16 23321333 nonsense probably null
R1911:St6gal1 UTSW 16 23321633 missense probably damaging 0.99
R2113:St6gal1 UTSW 16 23328417 missense probably damaging 0.98
R4591:St6gal1 UTSW 16 23321294 missense probably benign 0.00
R5761:St6gal1 UTSW 16 23321055 utr 5 prime probably benign
R6554:St6gal1 UTSW 16 23321655 missense probably benign 0.00
R6925:St6gal1 UTSW 16 23356213 missense probably damaging 1.00
R7658:St6gal1 UTSW 16 23356228 missense probably damaging 1.00
R7740:St6gal1 UTSW 16 23321035 splice site probably benign
R8017:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8018:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8019:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8122:St6gal1 UTSW 16 23354894 missense probably benign 0.00
R8123:St6gal1 UTSW 16 23357835 missense probably benign 0.01
R8124:St6gal1 UTSW 16 23357835 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGATGACGCTGTGTGACC -3'
(R):5'- ATCTGGGCTCCCATACTCTG -3'

Sequencing Primer
(F):5'- CGCTGTGTGACCAAGTTGATATTTAC -3'
(R):5'- TTGCCATCAGACACTGGAG -3'
Posted On2020-01-23