Incidental Mutation 'R8044:Efhb'
ID618686
Institutional Source Beutler Lab
Gene Symbol Efhb
Ensembl Gene ENSMUSG00000023931
Gene NameEF hand domain family, member B
Synonyms4921525D22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8044 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location53398889-53463321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53399115 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 798 (S798L)
Ref Sequence ENSEMBL: ENSMUSP00000024725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024725]
Predicted Effect probably benign
Transcript: ENSMUST00000024725
AA Change: S798L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024725
Gene: ENSMUSG00000023931
AA Change: S798L

DomainStartEndE-ValueType
low complexity region 565 574 N/A INTRINSIC
EFh 585 613 2.14e-1 SMART
EFh 621 649 1.98e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik T C 8: 85,412,118 E114G possibly damaging Het
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Asb7 T C 7: 66,659,763 N235S probably benign Het
Atrn A T 2: 130,935,529 N166I probably damaging Het
C87499 T G 4: 88,629,975 E64D possibly damaging Het
Cd300ld2 C T 11: 115,013,719 W107* probably null Het
Chl1 A T 6: 103,706,632 E806D probably damaging Het
Dnajb12 A G 10: 59,896,350 K337R possibly damaging Het
Dock5 T C 14: 67,824,692 D409G probably damaging Het
Gpd1 T C 15: 99,723,202 F322S probably damaging Het
Gria4 A G 9: 4,456,216 Y695H probably damaging Het
Ipo8 A G 6: 148,809,923 F289S probably damaging Het
Jakmip1 A G 5: 37,154,644 E72G unknown Het
Mettl14 T C 3: 123,369,660 N366S probably benign Het
Ntrk2 A G 13: 59,126,499 T730A probably damaging Het
Olfr1453 T C 19: 13,027,465 Y288C probably damaging Het
Otop3 T C 11: 115,346,435 L575P probably damaging Het
Piwil2 T C 14: 70,391,438 S710G possibly damaging Het
Ptpra A G 2: 130,544,961 K627E possibly damaging Het
Rab24 A G 13: 55,321,532 probably benign Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rpe65 T C 3: 159,614,705 F300L probably benign Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tert A G 13: 73,635,449 E590G probably damaging Het
Tlr4 C A 4: 66,827,847 L6I probably benign Het
Trim3 G A 7: 105,613,258 silent Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Ube3a A T 7: 59,276,572 H387L possibly damaging Het
Ugt1a7c G A 1: 88,095,556 V146M probably damaging Het
Upf2 T C 2: 6,029,438 I974T unknown Het
Vmn1r38 A T 6: 66,776,532 I200N probably benign Het
Wnt5b A G 6: 119,446,358 V115A probably damaging Het
Xpo7 C A 14: 70,684,926 R574L probably benign Het
Other mutations in Efhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Efhb APN 17 53462453 missense probably damaging 1.00
IGL00990:Efhb APN 17 53462621 missense possibly damaging 0.86
IGL02041:Efhb APN 17 53426259 missense probably damaging 1.00
IGL02247:Efhb APN 17 53401624 missense probably benign 0.00
IGL02637:Efhb APN 17 53449552 missense probably benign 0.26
IGL02704:Efhb APN 17 53426269 missense probably damaging 1.00
IGL03083:Efhb APN 17 53399059 missense probably damaging 1.00
IGL03090:Efhb APN 17 53462930 missense probably benign 0.01
IGL03221:Efhb APN 17 53398986 missense probably damaging 1.00
PIT4531001:Efhb UTSW 17 53445775 missense probably damaging 1.00
R0632:Efhb UTSW 17 53413459 splice site probably benign
R1234:Efhb UTSW 17 53451587 nonsense probably null
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1471:Efhb UTSW 17 53399112 missense possibly damaging 0.46
R1624:Efhb UTSW 17 53426278 missense probably damaging 1.00
R2019:Efhb UTSW 17 53401477 missense probably damaging 1.00
R2085:Efhb UTSW 17 53426909 critical splice donor site probably null
R2226:Efhb UTSW 17 53462429 critical splice donor site probably null
R2415:Efhb UTSW 17 53463096 missense probably benign 0.01
R3848:Efhb UTSW 17 53426996 splice site probably benign
R3858:Efhb UTSW 17 53462780 missense possibly damaging 0.61
R4581:Efhb UTSW 17 53426275 missense probably damaging 1.00
R4712:Efhb UTSW 17 53451669 missense probably damaging 1.00
R4731:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4732:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4733:Efhb UTSW 17 53426244 missense probably damaging 1.00
R5375:Efhb UTSW 17 53401626 missense possibly damaging 0.93
R5886:Efhb UTSW 17 53451554 missense probably benign 0.42
R6054:Efhb UTSW 17 53398999 missense possibly damaging 0.90
R6195:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6233:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6450:Efhb UTSW 17 53452604 missense possibly damaging 0.77
R6550:Efhb UTSW 17 53421940 missense probably benign 0.06
R6701:Efhb UTSW 17 53399063 missense probably benign 0.41
R6967:Efhb UTSW 17 53463168 missense probably benign 0.03
R7157:Efhb UTSW 17 53400900 missense probably damaging 1.00
R7441:Efhb UTSW 17 53401521 missense possibly damaging 0.78
R7694:Efhb UTSW 17 53400808 missense probably damaging 0.99
R8176:Efhb UTSW 17 53400846 missense probably damaging 1.00
R8309:Efhb UTSW 17 53449535 missense probably damaging 0.99
R8311:Efhb UTSW 17 53413461 critical splice donor site probably null
R8821:Efhb UTSW 17 53400744 critical splice donor site probably benign
R8882:Efhb UTSW 17 53462684 missense probably damaging 1.00
RF003:Efhb UTSW 17 53400891 missense probably damaging 1.00
RF012:Efhb UTSW 17 53413517 missense probably damaging 0.97
Z1177:Efhb UTSW 17 53437126 missense possibly damaging 0.94
Z1177:Efhb UTSW 17 53437183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGCTTTGCTTAAATGTGTAAGTTCCC -3'
(R):5'- TGCCTGAAAAGTACTACAACTTTG -3'

Sequencing Primer
(F):5'- GTTCCCAAAAATATCAATCACATGG -3'
(R):5'- ACTTTTGTGGAGGACCAG -3'
Posted On2020-01-23