Incidental Mutation 'R8044:Or5b101'
ID 618687
Institutional Source Beutler Lab
Gene Symbol Or5b101
Ensembl Gene ENSMUSG00000094755
Gene Name olfactory receptor family 5 subfamily B member 101
Synonyms Olfr1453, GA_x6K02T2RE5P-3357666-3356743, MOR202-6
MMRRC Submission 067481-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R8044 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13004768-13005691 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13004829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 288 (Y288C)
Ref Sequence ENSEMBL: ENSMUSP00000085071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087773]
AlphaFold Q8VFX0
Predicted Effect probably damaging
Transcript: ENSMUST00000087773
AA Change: Y288C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085071
Gene: ENSMUSG00000094755
AA Change: Y288C

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.6e-50 PFAM
Pfam:7tm_1 39 288 2.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik T C 8: 86,138,747 (GRCm39) E114G possibly damaging Het
Abcc4 ACCAGCCC ACC 14: 118,852,682 (GRCm39) probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Asb7 T C 7: 66,309,511 (GRCm39) N235S probably benign Het
Atrn A T 2: 130,777,449 (GRCm39) N166I probably damaging Het
Cd300ld2 C T 11: 114,904,545 (GRCm39) W107* probably null Het
Chl1 A T 6: 103,683,593 (GRCm39) E806D probably damaging Het
Dnajb12 A G 10: 59,732,172 (GRCm39) K337R possibly damaging Het
Dock5 T C 14: 68,062,141 (GRCm39) D409G probably damaging Het
Efhb G A 17: 53,706,143 (GRCm39) S798L probably benign Het
Gpd1 T C 15: 99,621,083 (GRCm39) F322S probably damaging Het
Gria4 A G 9: 4,456,216 (GRCm39) Y695H probably damaging Het
Ipo8 A G 6: 148,711,421 (GRCm39) F289S probably damaging Het
Jakmip1 A G 5: 37,311,988 (GRCm39) E72G unknown Het
Mettl14 T C 3: 123,163,309 (GRCm39) N366S probably benign Het
Ntrk2 A G 13: 59,274,313 (GRCm39) T730A probably damaging Het
Otop3 T C 11: 115,237,261 (GRCm39) L575P probably damaging Het
Piwil2 T C 14: 70,628,887 (GRCm39) S710G possibly damaging Het
Pramel32 T G 4: 88,548,212 (GRCm39) E64D possibly damaging Het
Ptpra A G 2: 130,386,881 (GRCm39) K627E possibly damaging Het
Rab24 A G 13: 55,469,345 (GRCm39) probably benign Het
Rbm20 C A 19: 53,806,402 (GRCm39) A494D probably benign Het
Rpe65 T C 3: 159,320,342 (GRCm39) F300L probably benign Het
St6gal1 G A 16: 23,176,585 (GRCm39) A393T probably benign Het
Tert A G 13: 73,783,568 (GRCm39) E590G probably damaging Het
Tlr4 C A 4: 66,746,084 (GRCm39) L6I probably benign Het
Trim3 G A 7: 105,262,465 (GRCm39) silent Het
Tubg1 G T 11: 101,014,854 (GRCm39) A199S probably benign Het
Ube3a A T 7: 58,926,320 (GRCm39) H387L possibly damaging Het
Ugt1a7c G A 1: 88,023,278 (GRCm39) V146M probably damaging Het
Upf2 T C 2: 6,034,249 (GRCm39) I974T unknown Het
Vmn1r38 A T 6: 66,753,516 (GRCm39) I200N probably benign Het
Wnt5b A G 6: 119,423,319 (GRCm39) V115A probably damaging Het
Xpo7 C A 14: 70,922,366 (GRCm39) R574L probably benign Het
Other mutations in Or5b101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Or5b101 APN 19 13,004,955 (GRCm39) missense probably damaging 0.98
IGL01137:Or5b101 APN 19 13,005,394 (GRCm39) missense possibly damaging 0.52
IGL01894:Or5b101 APN 19 13,005,649 (GRCm39) missense probably damaging 1.00
IGL02579:Or5b101 APN 19 13,004,892 (GRCm39) missense probably damaging 0.99
PIT4418001:Or5b101 UTSW 19 13,005,095 (GRCm39) nonsense probably null
R0099:Or5b101 UTSW 19 13,005,165 (GRCm39) missense probably damaging 1.00
R0211:Or5b101 UTSW 19 13,005,646 (GRCm39) missense possibly damaging 0.95
R0211:Or5b101 UTSW 19 13,005,646 (GRCm39) missense possibly damaging 0.95
R0395:Or5b101 UTSW 19 13,005,663 (GRCm39) missense probably damaging 1.00
R0453:Or5b101 UTSW 19 13,005,295 (GRCm39) missense probably damaging 0.97
R0847:Or5b101 UTSW 19 13,005,095 (GRCm39) nonsense probably null
R1227:Or5b101 UTSW 19 13,005,217 (GRCm39) missense probably benign
R1823:Or5b101 UTSW 19 13,005,181 (GRCm39) missense probably benign 0.06
R2509:Or5b101 UTSW 19 13,005,058 (GRCm39) missense probably damaging 1.00
R2899:Or5b101 UTSW 19 13,005,058 (GRCm39) missense probably damaging 1.00
R2964:Or5b101 UTSW 19 13,005,412 (GRCm39) missense probably benign 0.38
R2965:Or5b101 UTSW 19 13,005,412 (GRCm39) missense probably benign 0.38
R3157:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3158:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3409:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3410:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3411:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R3425:Or5b101 UTSW 19 13,005,411 (GRCm39) missense probably benign 0.03
R4018:Or5b101 UTSW 19 13,005,189 (GRCm39) missense probably benign
R4668:Or5b101 UTSW 19 13,005,445 (GRCm39) missense probably benign 0.00
R4805:Or5b101 UTSW 19 13,005,661 (GRCm39) missense probably benign 0.04
R5180:Or5b101 UTSW 19 13,004,776 (GRCm39) missense probably benign 0.01
R5391:Or5b101 UTSW 19 13,005,150 (GRCm39) missense probably damaging 1.00
R5557:Or5b101 UTSW 19 13,005,004 (GRCm39) missense probably benign 0.01
R5740:Or5b101 UTSW 19 13,004,926 (GRCm39) missense probably benign 0.24
R7472:Or5b101 UTSW 19 13,005,439 (GRCm39) missense probably benign
R7832:Or5b101 UTSW 19 13,005,360 (GRCm39) missense probably benign 0.02
R7970:Or5b101 UTSW 19 13,005,058 (GRCm39) missense probably damaging 1.00
R8229:Or5b101 UTSW 19 13,005,561 (GRCm39) missense possibly damaging 0.55
R8474:Or5b101 UTSW 19 13,005,357 (GRCm39) missense probably damaging 1.00
R8951:Or5b101 UTSW 19 13,004,827 (GRCm39) missense
R8957:Or5b101 UTSW 19 13,004,881 (GRCm39) missense probably benign 0.03
R9046:Or5b101 UTSW 19 13,005,115 (GRCm39) missense probably benign 0.01
R9059:Or5b101 UTSW 19 13,005,277 (GRCm39) missense probably damaging 1.00
R9131:Or5b101 UTSW 19 13,005,360 (GRCm39) missense probably benign 0.02
R9266:Or5b101 UTSW 19 13,005,648 (GRCm39) missense probably damaging 1.00
R9269:Or5b101 UTSW 19 13,004,994 (GRCm39) missense probably benign
Z1088:Or5b101 UTSW 19 13,005,391 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCCAACACATCATTGCAGAGG -3'
(R):5'- AACATACTGAAGATCCACTCATCTG -3'

Sequencing Primer
(F):5'- CATCATTGCAGAGGTAGTCACATCAG -3'
(R):5'- CTGCAGGATATCACAAAGCTGTTTCC -3'
Posted On 2020-01-23